Search result

BaseInfo

ncRNA ID	novel_ath_miR738
Species	Arabidopsis thaliana
Class	miRNA
Genome position	Chr3:22122809-22122881 [-]
Reference genome	TAIR10
Source	ERR562745;ERR654971;ERR654972;ERR654973;ERR654975
Length	21
Mature sequence(if miRNA)	1 - UUAGAUGACCAUCAACAAACU - 21
Stem-loop(if miRNA)	--         U A      C  AU        UCC   UUUGUUGAU G UAUCUA AC  GUUGAUCA   U   ||||||||| | |||||| ||  ||||||||   U   AAACAACUA C GUAGAU UG  UAGCUAGU   G UC         C A      U  GU        UGU
Stem-loop sequence	UUUGUUGAUUGAUAUCUACACAUGUUGAUCAUCCUUGUGUUGAUCGAUUGGUUUAGAUGACCAUCAACAAACU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_100167.3	ncRNA:21   UCAAACAACUACCAGUAGAUU   1   *|||||||||||||||||||| targets:258   UGUUUGUUGAUGGUCAUCUAA   278 Target Full Sequence	0.0	Arabidopsis thaliana SPX (SYG1/Pho81/XPR1) domain-containing protein (NLA), mRNA	SPX (SYG1/Pho81/XPR1) domain-containing protein(NLA)	coding protein	psRNATarget
NM_001123746.1	ncRNA:21   UCAAACAACUACCAGUAGAUU   1   *|||||||||||||||||||| targets:258   UGUUUGUUGAUGGUCAUCUAA   278 Target Full Sequence	0.0	Arabidopsis thaliana SPX (SYG1/Pho81/XPR1) domain-containing protein (NLA), mRNA	SPX (SYG1/Pho81/XPR1) domain-containing protein(NLA)	coding protein	psRNATarget
BX816480.1	ncRNA:21   UCAAACAACUACCAGUAGAUU   1   *|||||||||||||||||||| targets:263   UGUUUGUUGAUGGUCAUCUAA   283 Target Full Sequence	0.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH50ZH05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AK229396.1	ncRNA:21   UCAAACAACUACCAGUAGAUU   1   *|||||||||||||||||||| targets:118   UGUUUGUUGAUGGUCAUCUAA   138 Target Full Sequence	0.0	Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL16-64-D14	NA	coding protein	psRNATarget
AY088823.1	ncRNA:21   UCAAACAACUACCAGUAGAUU   1   *|||||||||||||||||||| targets:118   UGUUUGUUGAUGGUCAUCUAA   138 Target Full Sequence	0.0	Arabidopsis thaliana clone 96370 mRNA, complete sequence	NA	coding protein	psRNATarget
BX813622.1	ncRNA:21   UCAAACAACUACCAGUAGAUU   1   *|||||||||||||||||||| targets:95   UGUUUGUUGAUGGUCAUCUAA   115 Target Full Sequence	0.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB28ZF12 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX814861.1	ncRNA:21   UCAAACAACUACCAGUAGAUU   1   *|||||||||||||||||||| targets:88   UGUUUGUUGAUGGUCAUCUAA   108 Target Full Sequence	0.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS12ZC01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX815668.1	ncRNA:21   UCAAACAACUACCAGUAGAUU   1   *|||||||||||||||||||| targets:88   UGUUUGUUGAUGGUCAUCUAA   108 Target Full Sequence	0.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS81ZH10 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
NM_001331361.1	ncRNA:21   UCAAACAACUACCAGUAGAUU   1   *|||||||||||||||||||| targets:258   UGUUUGUUGAUGGUCAUCUAA   278 Target Full Sequence	0.0	Arabidopsis thaliana SPX (SYG1/Pho81/XPR1) domain-containing protein (NLA), partial mRNA	SPX (SYG1/Pho81/XPR1) domain-containing protein(NLA)	coding protein	psRNATarget