Search result

BaseInfo

ncRNA ID	ath-miRf10508-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	21
Mature sequence(if miRNA)	NA - ACCGUCGAGAAUUUUGGAGAA - NA
Stem-loop(if miRNA)	A       CG   UU   C      AU    AAG  -G G    GG   AUAUAGCAAUC GCG UCGCUUC  CGA  UUC CGGCGG  UUGU   CG  C GCGC  UGC           A ||| |||||||  |||  ||| ||||||  ||||   ||  | ||||  ||| UGC AGUGAAG  GUU  AAG GCUGCC  AGCA   GC  G CGCG  UGU           G    -       AG   UU   A      --    GCA  AG G    -G   UCCUAAGGAGC
Stem-loop sequence	GCGAUCGCUUCCGCGAUUUUCCCGGCGGAUUUGUAAGCGGCGGCGCGGUGCAUAUAGCAAUCAGCGAGGAAUCCUUGUGGCGCGGGACGACGACGACCGUCGAGAAUUUUGGAGAAGUGACGU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
BT002307.1	ncRNA:21   AAGAGGUUUUAAGAGCUGCCA   1   ||||||||||||||||||||| targets:787   UUCUCCAAAAUUCUCGACGGU   807 Target Full Sequence	0.0	Arabidopsis thaliana At3g62570/T12C14_270 mRNA, complete cds	NA	coding protein	psRNATarget
BX826077.1	ncRNA:21   AAGAGGUUUUAAGAGCUGCCA   1   ||||||||||||||||||||| targets:833   UUCUCCAAAAUUCUCGACGGU   853 Target Full Sequence	0.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL83ZE03 of Silique of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AF419555.1	ncRNA:21   AAGAGGUUUUAAGAGCUGCCA   1   ||||||||||||||||||||| targets:832   UUCUCCAAAAUUCUCGACGGU   852 Target Full Sequence	0.0	Arabidopsis thaliana AT3g62570/T12C14_270 mRNA, complete cds	NA	coding protein	psRNATarget
BX824159.1	ncRNA:21   AAGAGGUUUUAAGAGCUGCCA   1   ||||||||||||||||||||| targets:842   UUCUCCAAAAUUCUCGACGGU   862 Target Full Sequence	0.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH27ZA09 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
NM_116122.4	ncRNA:21   AAGAGGUUUUAAGAGCUGCCA   1   ||||||||||||||||||||| targets:918   UUCUCCAAAAUUCUCGACGGU   938 Target Full Sequence	0.0	Arabidopsis thaliana Tetratricopeptide repeat (TPR)-like superfamily protein mRNA	Tetratricopeptide repeat (TPR)-like superfamily protein(AT3G62570)	coding protein	psRNATarget
AK229446.1	ncRNA:21   AAGAGGUUUUAAGAGCUGCCA   1   |||*||=|||||||||||||| targets:62   UUCCCCGAAAUUCUCGACGGU   82 Target Full Sequence	2.0	Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL16-78-E07	NA	coding protein	psRNATarget
AY056805.1	ncRNA:21   AAGAGGUUUUAAGAGCUGCCA   1   |||*||=|||||||||||||| targets:58   UUCCCCGAAAUUCUCGACGGU   78 Target Full Sequence	2.0	Arabidopsis thaliana At2g05250/F5G3.15 mRNA, complete cds	NA	coding protein	psRNATarget
NM_126549.6	ncRNA:21   AAGAGGUUUUAAGAGCUGCCA   1   |||*||=|||||||||||||| targets:89   UUCCCCGAAAUUCUCGACGGU   109 Target Full Sequence	2.0	Arabidopsis thaliana DNAJ heat shock N-terminal domain-containing protein mRNA	DNAJ heat shock N-terminal domain-containing protein(AT2G05230)	coding protein	psRNATarget
NM_126550.2	ncRNA:21   AAGAGGUUUUAAGAGCUGCCA   1   |||*||=|||||||||||||| targets:94   UUCCCCGAAAUUCUCGACGGU   114 Target Full Sequence	2.0	Arabidopsis thaliana DNAJ heat shock N-terminal domain-containing protein mRNA	DNAJ heat shock N-terminal domain-containing protein(AT2G05250)	coding protein	psRNATarget