ncRNA ID | novel_ath_miR602 |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | Chr2:6010220-6010405 [-] |
Reference genome | TAIR10 |
Source | SRR3707788 |
Length | 24 |
Mature sequence(if miRNA) | 163 - AAAGAUCUUGUAGGCUAUAGUGAU - 186 |
Stem-loop(if miRNA) |
--A         U             A  AGCCAUA    GGAUGA G      GG AA   ACA    GGCAACU     ACC     G  U  CU    AAGAUCUUG AGGCUAUAGUGAU GC       ACGU      A AUGACG  A  AGC   ACUG       CUUUU   UGCAU AA GU  G    ||||||||| ||||||||||||| ||       ||||      | ||||||  |  |||   ||||       |||||   ||||| || ||    UUCUAGAAC UUCGGUAUCACUA CG       UGCG      U UGCUGC  U  UCG   UGGC       GAAAA   ACGUG UU CA  A UUC         -             A  AAACAUA    ---AAG G      UU -C   --A    AUAUAAC     CAC     G  -  UU |
Stem-loop sequence | AAAGAUCUUGUAGGCUAUAGUGAUAGCAGCCAUAACGUGGAUGAAGAUGACGGGAAAAGCACAACUGGGCAACUCUUUUACCUGCAUGAAUGUCUGAUUACUUGGUGCACACAAAAGCAAUAUACGGUAGCUCUUUCGUCGUGUGAAGCGUAUACAAAGCAAUCACUAUGGCUUCAAGAUCUUCUU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
NM_001343778.1 |
|
2.0 | Arabidopsis thaliana Serine carboxypeptidase S28 family protein mRNA | Serine carboxypeptidase S28 family protein(AT5G22860) | coding protein | psRNATarget | |||||||||
NM_001343776.1 |
|
2.0 | Arabidopsis thaliana Serine carboxypeptidase S28 family protein mRNA | Serine carboxypeptidase S28 family protein(AT5G22860) | coding protein | psRNATarget | |||||||||
NM_001343777.1 |
|
2.0 | Arabidopsis thaliana Serine carboxypeptidase S28 family protein mRNA | Serine carboxypeptidase S28 family protein(AT5G22860) | coding protein | psRNATarget | |||||||||
BX825953.1 |
|
2.5 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL75ZF07 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget |