Search result

BaseInfo

ncRNA ID	novel_ath_miR564
Species	Arabidopsis thaliana
Class	miRNA
Genome position	Chr3:10113383-10113441 [-]
Reference genome	TAIR10
Source	SRR3707785;SRR3707786;SRR3707788;SRR3707790;SRR3707792;SRR3707796;SRR3707797;SRR3707798;SRR3707799
Length	21
Mature sequence(if miRNA)	39 - UUUCUCAAUCUUUCGGACGUG - 59
Stem-loop(if miRNA)	----             CG     GCUCCU     UUUCUCAAUCUUU  GACGU      A     |||||||||||||  |||||      U     AAAGAGUUAGAAA  CUGUA      A CUAA             AG     ACCAAU
Stem-loop sequence	UUUCUCAAUCUUUCGGACGUGCUCCUAUAUAACCAAUGUCGAAAAGAUUGAGAAAAAUC

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_001339686.1	ncRNA:21   GUGCAGGCUUUCUAACUCUUU   1   *==||==|||||||||||||| targets:2067   AGUGUUUGAAAGAUUGAGAAA   2087 Target Full Sequence	3.0	Arabidopsis thaliana Structural maintenance of chromosomes (SMC) family protein (TTN8), mRNA	Structural maintenance of chromosomes (SMC) family protein(TTN8)	coding protein	psRNATarget
AY567966.1	ncRNA:21   GUGCAGGCUUUCUAACUCUUU   1   *==||==|||||||||||||| targets:1895   AGUGUUUGAAAGAUUGAGAAA   1915 Target Full Sequence	3.0	Arabidopsis thaliana structural maintenance of chromosomes 1 protein (SMC1) mRNA, complete cds	NA	coding protein	psRNATarget
KM397432.1	ncRNA:21   GUGCAGGCUUUCUAACUCUUU   1   *==||==|||||||||||||| targets:1683   AGUGUUUGAAAGAUUGAGAAA   1703 Target Full Sequence	3.0	Arabidopsis thaliana structural maintenance of chromosomes protein 1 mRNA, partial cds	NA	coding protein	psRNATarget