Search result

BaseInfo

ncRNA ID	novel_ath_miR520
Species	Arabidopsis thaliana
Class	miRNA
Genome position	Chr5:3887173-3887269 [+]
Reference genome	TAIR10
Source	SRR3178443
Length	21
Mature sequence(if miRNA)	1 - ACUUGUAUUGAUAGCCAAAAG - 21
Stem-loop(if miRNA)	--               CA          A  A   --   ACAU   U   ACUUGUAUUGAUAGC  AAAGAGAGAU CA GUU  CUG    UUC U   |||||||||||||||  |||||||||| || |||  |||    ||| A   UGAACAUAACUAUUG  UUUCUUUUUA GU CAA  GAU    AAG A UA               AG          C  C   AC   ACUU   U
Stem-loop sequence	ACUUGUAUUGAUAGCCAAAAGAGAGAUACAAGUUCUGACAUUUCUUAAUGAAUUCAUAGCAAACCUGCAUUUUUCUUUGAGUUAUCAAUACAAGUAU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
BX829894.1	ncRNA:21   GAAAAC-CGAUAGUUAUGUUCA   1   =*||||-|=||||||||||||| targets:942   UCUUUGAGUUAUCAAUACAAGU   963 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB44ZD08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX829895.1	ncRNA:21   GAAAAC-CGAUAGUUAUGUUCA   1   =*||||-|=||||||||||||| targets:946   UCUUUGAGUUAUCAAUACAAGU   967 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB44ZD09 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
NM_203040.1	ncRNA:21   GAAAAC-CGAUAGUUAUGUUCA   1   =*||||-|=||||||||||||| targets:969   UCUUUGAGUUAUCAAUACAAGU   990 Target Full Sequence	3.0	Arabidopsis thaliana Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase family protein mRNA	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase family protein(AT5G12040)	coding protein	psRNATarget