Search result

BaseInfo

ncRNA ID	novel_ath_miR502
Species	Arabidopsis thaliana
Class	miRNA
Genome position	Chr3:3011231-3011306 [+]
Reference genome	TAIR10
Source	SRR3178440
Length	20
Mature sequence(if miRNA)	1 - GUUCUUGCAGAGCUGUAUUA - 20
Stem-loop(if miRNA)	--      G   -AG       A      C  CCUUUAA   GUUCUU CAG   CUGUAUU CUUCUU UG       G   |||||| |||   ||||||| |||||| ||   UAAGAA GUU   GACAUAG GAAGAA AC       A CC      G   AUA       -      A  AAUACCU
Stem-loop sequence	GUUCUUGCAGAGCUGUAUUACUUCUUCUGCCUUUAAGAUCCAUAACAAAAGAAGGAUACAGAUAUUGGAAGAAUCC

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_001331248.1	ncRNA:20   AUUAUGUCGAGACGUUCUUG   1   *||*||||||||||||||*| targets:1378   AAACACAGCUCUGCAAGAUC   1397 Target Full Sequence	2.5	Arabidopsis thaliana Homeodomain-like superfamily protein (LHY), mRNA	Homeodomain-like superfamily protein(LHY)	coding protein	psRNATarget
AK316829.1	ncRNA:20   AUUAUGUCGAGACGUUCUUG   1   *||*||||||||||||||*| targets:1259   AAACACAGCUCUGCAAGAUC   1278 Target Full Sequence	2.5	Arabidopsis thaliana AT1G01060 mRNA, complete cds, clone: RAFL07-43-F02	NA	coding protein	psRNATarget
BX817115.1	ncRNA:20   AUUAUGUCGAGACGUUCUUG   1   *||*||||||||||||||*| targets:1636   AAACACAGCUCUGCAAGAUC   1655 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH86ZB04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
NM_001035847.1	ncRNA:20   AUUAUGUCGAGACGUUCUUG   1   *||*||||||||||||||*| targets:1566   AAACACAGCUCUGCAAGAUC   1585 Target Full Sequence	2.5	Arabidopsis thaliana Homeodomain-like superfamily protein (LHY), mRNA	Homeodomain-like superfamily protein(LHY)	coding protein	psRNATarget
AJ006404.1	ncRNA:20   AUUAUGUCGAGACGUUCUUG   1   *||*||||||||||||||*| targets:1546   AAACACAGCUCUGCAAGAUC   1565 Target Full Sequence	2.5	Arabidopsis thaliana mRNA for LATE ELONGATED HYPOCOTYL MYB transcription factor	NA	coding protein	psRNATarget
NM_001083968.1	ncRNA:20   AUUAUGUCGAGACGUUCUUG   1   *||*||||||||||||||*| targets:1586   AAACACAGCUCUGCAAGAUC   1605 Target Full Sequence	2.5	Arabidopsis thaliana Homeodomain-like superfamily protein (LHY), mRNA	Homeodomain-like superfamily protein(LHY)	coding protein	psRNATarget
NM_099988.4	ncRNA:20   AUUAUGUCGAGACGUUCUUG   1   *||*||||||||||||||*| targets:1649   AAACACAGCUCUGCAAGAUC   1668 Target Full Sequence	2.5	Arabidopsis thaliana Homeodomain-like superfamily protein (LHY), mRNA	Homeodomain-like superfamily protein(LHY)	coding protein	psRNATarget
NM_001197953.1	ncRNA:20   AUUAUGUCGAGACGUUCUUG   1   *||*||||||||||||||*| targets:1968   AAACACAGCUCUGCAAGAUC   1987 Target Full Sequence	2.5	Arabidopsis thaliana Homeodomain-like superfamily protein (LHY), mRNA	Homeodomain-like superfamily protein(LHY)	coding protein	psRNATarget
AK316728.1	ncRNA:20   AUUAUGUCGAGACGUUCUUG   1   *||*||||||||||||||*| targets:1759   AAACACAGCUCUGCAAGAUC   1778 Target Full Sequence	2.5	Arabidopsis thaliana AT1G01060 mRNA, complete cds, clone: RAFL04-17-F21	NA	coding protein	psRNATarget
NM_179237.1	ncRNA:20   AUUAUGUCGAGACGUUCUUG   1   *||*||||||||||||||*| targets:1759   AAACACAGCUCUGCAAGAUC   1778 Target Full Sequence	2.5	Arabidopsis thaliana Homeodomain-like superfamily protein (LHY), mRNA	Homeodomain-like superfamily protein(LHY)	coding protein	psRNATarget
NM_001331247.1	ncRNA:20   AUUAUGUCGAGACGUUCUUG   1   *||*||||||||||||||*| targets:1849   AAACACAGCUCUGCAAGAUC   1868 Target Full Sequence	2.5	Arabidopsis thaliana Homeodomain-like superfamily protein (LHY), mRNA	Homeodomain-like superfamily protein(LHY)	coding protein	psRNATarget
NM_001331246.1	ncRNA:20   AUUAUGUCGAGACGUUCUUG   1   *||*||||||||||||||*| targets:1968   AAACACAGCUCUGCAAGAUC   1987 Target Full Sequence	2.5	Arabidopsis thaliana Homeodomain-like superfamily protein (LHY), mRNA	Homeodomain-like superfamily protein(LHY)	coding protein	psRNATarget