Search result

BaseInfo

ncRNA ID	novel_ath_miR489
Species	Arabidopsis thaliana
Class	miRNA
Genome position	Chr5:10607718-10607801 [-]
Reference genome	TAIR10
Source	SRR3178439
Length	24
Mature sequence(if miRNA)	1 - GUGUGCAACACAAAUGACCCUAGG - 24
Stem-loop(if miRNA)	--A    A        -   A -- -- GUGGCGAACUCAUCAAC    AGGG UCGUUUGU UUG G  A  U                 A    |||| |||||||| ||| |  |  |    UCCC AGUAAACA AAC U  G  G                 A GGA    -        C   G GU UA AGAGCGGUGUAAAGAAG
Stem-loop sequence	AAGGGAUCGUUUGUUUGAGAUGUGGCGAACUCAUCAACAAGAAGAAAUGUGGCGAGAGAUGUGUGCAACACAAAUGACCCUAGG

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
AY142571.1	ncRNA:24   GGAUCCCAGUAAACACAACGUGUG   1   |||-|***|||||||||||||||| targets:640   CCU-GCACCAUUUGUGUUGCACAC   662 Target Full Sequence	3.0	Arabidopsis thaliana putative aminotransferase (At3g22200) mRNA, complete cds	NA	coding protein	psRNATarget
BX823758.1	ncRNA:24   GGAUCCCAGUAAACACAACGUGUG   1   |||-|***|||||||||||||||| targets:755   CCU-GCACCAUUUGUGUUGCACAC   777 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS72ZE04 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AF351125.1	ncRNA:24   GGAUCCCAGUAAACACAACGUGUG   1   |||-|***|||||||||||||||| targets:742   CCU-GCACCAUUUGUGUUGCACAC   764 Target Full Sequence	3.0	Arabidopsis thaliana gamma-aminobutyrate transaminase subunit precursor, mRNA, complete cds; nuclear gene for mitochondrial product	NA	coding protein	psRNATarget
AY034923.1	ncRNA:24   GGAUCCCAGUAAACACAACGUGUG   1   |||-|***|||||||||||||||| targets:768   CCU-GCACCAUUUGUGUUGCACAC   790 Target Full Sequence	3.0	Arabidopsis thaliana putative aminotransferase (At3g22200) mRNA, complete cds	NA	coding protein	psRNATarget
NM_113117.4	ncRNA:24   GGAUCCCAGUAAACACAACGUGUG   1   |||-|***|||||||||||||||| targets:777   CCU-GCACCAUUUGUGUUGCACAC   799 Target Full Sequence	3.0	Arabidopsis thaliana Pyridoxal phosphate (PLP)-dependent transferases superfamily protein (POP2), mRNA	Pyridoxal phosphate (PLP)-dependent transferases superfamily protein(POP2)	coding protein	psRNATarget
NM_001203018.1	ncRNA:24   GGAUCCCAGUAAACACAACGUGUG   1   |||-|***|||||||||||||||| targets:980   CCU-GCACCAUUUGUGUUGCACAC   1002 Target Full Sequence	3.0	Arabidopsis thaliana Pyridoxal phosphate (PLP)-dependent transferases superfamily protein (POP2), mRNA	Pyridoxal phosphate (PLP)-dependent transferases superfamily protein(POP2)	coding protein	psRNATarget