Search result

BaseInfo

ncRNA ID	novel_ath_miR479
Species	Arabidopsis thaliana
Class	miRNA
Genome position	Chr1:19934206-19934292 [-]
Reference genome	TAIR10
Source	SRR3048748;ERR562746
Length	24
Mature sequence(if miRNA)	1 - AGAGCAACUCCAACCAUUGACACC - 24
Stem-loop(if miRNA)	---UUG    -   A      AU      AAUUAUAUAGCAA         C       AAUG UUG GGGUUG  CUCUGG             AAAUUAAAU A       |||| ||| ||||||  ||||||             |||||||||       UUAC AAC CUCAAC  GAGAUU             UUUGAUUUA U CCACAG    C   -      --      ------------A         A
Stem-loop sequence	UUGAAUGUUGAGGGUUGAUCUCUGGAAUUAUAUAGCAAAAAUUAAAUCAUAAUUUAGUUUAUUAGAGCAACUCCAACCAUUGACACC

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
AF332417.1	ncRNA:24   CCACAGUUACCAACCUCAACGAGA   1   **|||||=*||||||||||||||* targets:927   UUUGUCAGCGGUUGGAGUUGCUCC   950 Target Full Sequence	3.0	Arabidopsis thaliana putative sterol-C-methyltransferase (At1g20330) mRNA, complete cds	NA	coding protein	psRNATarget
AY113961.1	ncRNA:24   CCACAGUUACCAACCUCAACGAGA   1   **|||||=*||||||||||||||* targets:927   UUUGUCAGCGGUUGGAGUUGCUCC   950 Target Full Sequence	3.0	Arabidopsis thaliana putative sterol-C-methyltransferase (At1g20330) mRNA, complete cds	NA	coding protein	psRNATarget
BT002093.1	ncRNA:24   CCACAGUUACCAACCUCAACGAGA   1   **|||||=*||||||||||||||* targets:927   UUUGUCAGCGGUUGGAGUUGCUCC   950 Target Full Sequence	3.0	Arabidopsis thaliana 24-sterol C-methyltransferase (At1g20330) mRNA, complete cds	NA	coding protein	psRNATarget
BX815399.1	ncRNA:24   CCACAGUUACCAACCUCAACGAGA   1   **|||||=*||||||||||||||* targets:980   UUUGUCAGCGGUUGGAGUUGCUCC   1003 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS57ZG06 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY128389.1	ncRNA:24   CCACAGUUACCAACCUCAACGAGA   1   **|||||=*||||||||||||||* targets:1017   UUUGUCAGCGGUUGGAGUUGCUCC   1040 Target Full Sequence	3.0	Arabidopsis thaliana 24-sterol C-methyltransferase (At1g20330) mRNA, complete cds	NA	coding protein	psRNATarget
BX814372.1	ncRNA:24   CCACAGUUACCAACCUCAACGAGA   1   **|||||=*||||||||||||||* targets:993   UUUGUCAGCGGUUGGAGUUGCUCC   1016 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB70ZA09 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX817173.1	ncRNA:24   CCACAGUUACCAACCUCAACGAGA   1   **|||||=*||||||||||||||* targets:1002   UUUGUCAGCGGUUGGAGUUGCUCC   1025 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH90ZB12 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX815494.1	ncRNA:24   CCACAGUUACCAACCUCAACGAGA   1   **|||||=*||||||||||||||* targets:952   UUUGUCAGCGGUUGGAGUUGCUCC   975 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS66ZF07 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BT000750.1	ncRNA:24   CCACAGUUACCAACCUCAACGAGA   1   **|||||=*||||||||||||||* targets:984   UUUGUCAGCGGUUGGAGUUGCUCC   1007 Target Full Sequence	3.0	Arabidopsis thaliana clone RAFL09-74-F07 (R19368) putative sterol-C-methyltransferase (At1g20330) mRNA, complete cds	NA	coding protein	psRNATarget
X89867.1	ncRNA:24   CCACAGUUACCAACCUCAACGAGA   1   **|||||=*||||||||||||||* targets:969   UUUGUCAGCGGUUGGAGUUGCUCC   992 Target Full Sequence	3.0	A.thaliana mRNA for sterol-C-methyltransferase	NA	coding protein	psRNATarget
AY046042.1	ncRNA:24   CCACAGUUACCAACCUCAACGAGA   1   **|||||=*||||||||||||||* targets:998   UUUGUCAGCGGUUGGAGUUGCUCC   1021 Target Full Sequence	3.0	Arabidopsis thaliana putative sterol-C-methyltransferase (At1g20330) mRNA, complete cds	NA	coding protein	psRNATarget
AY086699.1	ncRNA:24   CCACAGUUACCAACCUCAACGAGA   1   **|||||=*||||||||||||||* targets:1033   UUUGUCAGCGGUUGGAGUUGCUCC   1056 Target Full Sequence	3.0	Arabidopsis thaliana clone 2688 mRNA, complete sequence	NA	coding protein	psRNATarget
NM_101884.4	ncRNA:24   CCACAGUUACCAACCUCAACGAGA   1   **|||||=*||||||||||||||* targets:1105   UUUGUCAGCGGUUGGAGUUGCUCC   1128 Target Full Sequence	3.0	Arabidopsis thaliana sterol methyltransferase 2 (SMT2), mRNA	sterol methyltransferase 2(SMT2)	coding protein	psRNATarget
BX816582.1	ncRNA:24   CCACAGUUACCAACCUCAACGAGA   1   |***||==||*||||||||||||| targets:1079   GAACUCGGUGCUUGGAGUUGCUCU   1102 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH56ZH01 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget