ncRNA ID | novel_ath_miR470 |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | Chr1:6318338-6318415 [-] |
Reference genome | TAIR10 |
Source | SRR2721745;ERR1337931;SRR3992484;SRR1265989 |
Length | 21 |
Mature sequence(if miRNA) | 1 - UUAUGUGAUACAUUGACCUCC - 21 |
Stem-loop(if miRNA) |
--  A              -U    AGU  U --    UG   AG UCAAUGUAUUAUAU  AUAC   AG C  GGUU  C   || ||||||||||||||  ||||   || |  ||||  U   UC AGUUACAUAGUGUA  UGUG   UC G  CCAG  C CC  C              UU    ACU  U AA    UU |
Stem-loop sequence | AGAUCAAUGUAUUAUAUUAUACAGUAGUCGGUUUGCUCUUGACCAAGUCUUCAGUGUUUAUGUGAUACAUUGACCUCC |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
BX813884.1 |
|
2.5 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB45ZD05 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget |