Search result

BaseInfo

ncRNA ID	novel_ath_miR439
Species	Arabidopsis thaliana
Class	miRNA
Genome position	Chr2:1777614-1777689 [-]
Reference genome	TAIR10
Source	SRR2219515
Length	20
Mature sequence(if miRNA)	1 - AGUAAGAGAGAGAAAAGAGA - 20
Stem-loop(if miRNA)	---UCA       ---A  CUUUGGUUAGUUUCUUGUUUU       UUCUCUC    GU                     G       |||||||    ||       AAGAGAG    UG                     A AGAGAA       AGAA  AUUAGCAAAAUACAGAAGCAC
Stem-loop sequence	UCAUUCUCUCAGUCUUUGGUUAGUUUCUUGUUUUGACACGAAGACAUAAAACGAUUAGUAAGAGAGAGAAAAGAGA

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_130224.8	ncRNA:20   AGAGAAAAGAGAGAGAAUGA   1   ||||||*|||=||||||||| targets:340   UCUCUUAUCUUUCUCUUACU   359 Target Full Sequence	2.5	Arabidopsis thaliana Dof-type zinc finger DNA-binding family protein (DAG2), mRNA	Dof-type zinc finger DNA-binding family protein(DAG2)	coding protein	psRNATarget
BT003328.1	ncRNA:20   AGAGAAAAGAGAGAGAAUGA   1   ||||||*|||=||||||||| targets:36   UCUCUUAUCUUUCUCUUACU   55 Target Full Sequence	2.5	Arabidopsis thaliana putative DOF zinc finger protein (At2g46590) mRNA, complete cds	NA	coding protein	psRNATarget
BX819259.1	ncRNA:20   AGAGAAAAGAGAGAGAAUGA   1   ||||||*|||=||||||||| targets:25   UCUCUUAUCUUUCUCUUACU   44 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB60ZE11 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AB986563.1	ncRNA:20   AGAGAAAAGAGAGAGAAUGA   1   |||||||*|||||||||||* targets:297   UCUCUUUACUCUCUCUUACC   316 Target Full Sequence	2.5	Arabidopsis thaliana AtMTP12 mRNA for metal tolerance protein 12, complete cds	NA	coding protein	psRNATarget
NM_126491.3	ncRNA:20   AGAGAAAAGAGAGAGAAUGA   1   |||||||*|||||||||||* targets:272   UCUCUUUACUCUCUCUUACC   291 Target Full Sequence	2.5	Arabidopsis thaliana zinc transporter-like protein partial mRNA	zinc transporter-like protein(AT2G04620)	coding protein	psRNATarget
NM_129841.4	ncRNA:20   AGAGAAAAGAGAGAGAAUGA   1   |||||||*|||||||||||* targets:692   UCUCUUUCCUCUCUCUUACA   711 Target Full Sequence	2.5	Arabidopsis thaliana receptor like protein 29 (RLP29), mRNA	receptor like protein 29(RLP29)	coding protein	psRNATarget
BT023464.1	ncRNA:20   AGAGAAAAGAGAGAGAAUGA   1   |||||||*|||||||||||* targets:14   UCUCUUUCCUCUCUCUUACA   33 Target Full Sequence	2.5	Arabidopsis thaliana At2g42800 gene, complete cds	NA	coding protein	psRNATarget
NM_121026.5	ncRNA:20   AGAGAAA-AGAGAGAGAAUGA   1   |||||||-||||||||||||| targets:228   UCUCUUUCUCUCUCUCUUACU   248 Target Full Sequence	3.0	Arabidopsis thaliana Protein kinase family protein mRNA	Protein kinase family protein(AT5G09890)	coding protein	psRNATarget
NM_001036786.1	ncRNA:20   AGAGAAA-AGAGAGAGAAUGA   1   |||||||-||||||||||||| targets:119   UCUCUUUCUCUCUCUCUUACU   139 Target Full Sequence	3.0	Arabidopsis thaliana Protein kinase family protein mRNA	Protein kinase family protein(AT5G09890)	coding protein	psRNATarget
AY034932.1	ncRNA:20   AGAGAAA-AGAGAGAGAAUGA   1   |||||||-||||||||||||| targets:92   UCUCUUUCUCUCUCUCUUACU   112 Target Full Sequence	3.0	Arabidopsis thaliana putative protein kinase (At5g09890) mRNA, complete cds	NA	coding protein	psRNATarget
BX831288.1	ncRNA:20   AGAGAAA-AGAGAGAGAAUGA   1   |||||||-||||||||||||| targets:101   UCUCUUUCUCUCUCUCUUACU   121 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS75ZE11 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY086014.1	ncRNA:20   AGAGAAA-AGAGAGAGAAUGA   1   |||||||-||||||||||||| targets:75   UCUCUUUCUCUCUCUCUUACU   95 Target Full Sequence	3.0	Arabidopsis thaliana clone 206518 mRNA, complete sequence	NA	coding protein	psRNATarget
AB047278.1	ncRNA:20   AGAGAAA-AGAGAGAGAAUGA   1   |||||||-||||||||||||| targets:29   UCUCUUUCUCUCUCUCUUACU   49 Target Full Sequence	3.0	Arabidopsis thaliana AtNdr1 mRNA for Ndr kinase, complete cds	NA	coding protein	psRNATarget