Search result

BaseInfo

ncRNA ID	novel_ath_miR411
Species	Arabidopsis thaliana
Class	miRNA
Genome position	Chr4:2998768-2998811 [+]
Reference genome	TAIR10
Source	ERR1337928
Length	21
Mature sequence(if miRNA)	1 - UCGGAUUUGAAUGCCACUGGG - 21
Stem-loop(if miRNA)	--             C  C  G   UCGGAUUUGAAUG CA UG G   ||||||||||||| || ||   GGUCUGAAUUUAU GU AC G GG             A  A  A
Stem-loop sequence	UCGGAUUUGAAUGCCACUGGGGACAAUGAUAUUUAAGUCUGGGG

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
BX819165.1	ncRNA:21   GGGUCACCGUAAGUUUAGGCU   1   **|||||*||||||||*|||| targets:111   GGCAGUGUCAUUCAAAGCCGA   131 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB53ZC06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AK229584.1	ncRNA:21   GGGUCACCGUAAGUUUAGGCU   1   **|||||*||||||||*|||| targets:388   GGCAGUGUCAUUCAAAGCCGA   408 Target Full Sequence	2.5	Arabidopsis thaliana mRNA for hypothetical protein, partial sequence., clone: RAFL19-21-I03	NA	coding protein	psRNATarget
BX821135.1	ncRNA:21   GGGUCACCGUAAGUUUAGGCU   1   **|||||*||||||||*|||| targets:526   GGCAGUGUCAUUCAAAGCCGA   546 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL18ZG09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX821193.1	ncRNA:21   GGGUCACCGUAAGUUUAGGCU   1   **|||||*||||||||*|||| targets:621   GGCAGUGUCAUUCAAAGCCGA   641 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL24ZB05 of Silique of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY114007.1	ncRNA:21   GGGUCACCGUAAGUUUAGGCU   1   **|||||*||||||||*|||| targets:1225   GGCAGUGUCAUUCAAAGCCGA   1245 Target Full Sequence	2.5	Arabidopsis thaliana unknown protein (At2g45260) mRNA, complete cds	NA	coding protein	psRNATarget
BX819121.1	ncRNA:21   GGGUCACCGUAAGUUUAGGCU   1   **|||||*||||||||*|||| targets:1390   GGCAGUGUCAUUCAAAGCCGA   1410 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB49ZA09 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX819757.1	ncRNA:21   GGGUCACCGUAAGUUUAGGCU   1   **|||||*||||||||*|||| targets:1391   GGCAGUGUCAUUCAAAGCCGA   1411 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS23ZG04 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY091132.1	ncRNA:21   GGGUCACCGUAAGUUUAGGCU   1   **|||||*||||||||*|||| targets:1424   GGCAGUGUCAUUCAAAGCCGA   1444 Target Full Sequence	2.5	Arabidopsis thaliana unknown protein (At2g45260) mRNA, complete cds	NA	coding protein	psRNATarget
NM_130089.4	ncRNA:21   GGGUCACCGUAAGUUUAGGCU   1   **|||||*||||||||*|||| targets:1486   GGCAGUGUCAUUCAAAGCCGA   1506 Target Full Sequence	2.5	Arabidopsis thaliana myosin-4 protein (DUF641) mRNA	myosin-4 protein (DUF641)(AT2G45260)	coding protein	psRNATarget