Search result

BaseInfo

ncRNA ID	novel_ath_miR397
Species	Arabidopsis thaliana
Class	miRNA
Genome position	Chr3:10354835-10354931 [-]
Reference genome	TAIR10
Source	ERR1337928;SRR2721744;SRR2721746;SRR3178440;SRR3707788;ERR1297303
Length	21
Mature sequence(if miRNA)	1 - UUUUUAUAUAAAUGUAGUUUA - 21
Stem-loop(if miRNA)	--                     AGUAAUAAAUGAUAAAAA AAAAACAAGAUACGG   AACUACAUUUAUAUAAAAAGA                  G               U   |||||||||||||||||||||                  |   UUGAUGUAAAUAUAUUUUUCU                  U               A AU                     -----------------C CUCUCAUAUAAAUAA
Stem-loop sequence	AACUACAUUUAUAUAAAAAGAAGUAAUAAAUGAUAAAAAGAAAAACAAGAUACGGUAAAUAAAUAUACUCUCUCUCUUUUUAUAUAAAUGUAGUUUA

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_001338918.1	ncRNA:21   AUUUGAUGUAAAUAUAUUUUU   1   ||||||||||||||||||||| targets:1691   UAAACUACAUUUAUAUAAAAA   1711 Target Full Sequence	0.0	Arabidopsis thaliana hypothetical protein mRNA	hypothetical protein(AT3G27906)	coding protein	psRNATarget
BX822902.1	ncRNA:21   AUUUGAUGUAAAUAUAUUUUU   1   ||||||||||||||||||||| targets:1510   UAAACUACAUUUAUAUAAAAA   1530 Target Full Sequence	0.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB71ZB04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
EF182996.1	ncRNA:21   AUUUGAUGUAAAUAUAUUUUU   1   ||||||||||||||||||||| targets:1591   UAAACUACAUUUAUAUAAAAA   1611 Target Full Sequence	0.0	Arabidopsis thaliana clone asmbl_9717 unknown mRNA sequence	NA	coding protein	psRNATarget
EF183428.1	ncRNA:21   AUUUGAUGUAAAUAUAUUUUU   1   ||||||||||||||||||||| targets:1203   UAAACUACAUUUAUAUAAAAA   1223 Target Full Sequence	0.0	Arabidopsis thaliana clone asmbl_9719 unknown mRNA sequence	NA	coding protein	psRNATarget
AK229401.1	ncRNA:21   AUUUGAUGUAAAUAUAUUUUU   1   |||||||*||||||*|||||| targets:1070   UAAACUAAAUUUAUCUAAAAA   1090 Target Full Sequence	2.5	Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL16-65-B08	NA	coding protein	psRNATarget
NM_112161.3	ncRNA:21   AUUUGAUGUAAAUAUAUUUUU   1   ||*|=||*||||||||||||| targets:2116   UACAUUAGAUUUAUAUAAAAA   2136 Target Full Sequence	3.0	Arabidopsis thaliana crooked neck protein, putative / cell cycle protein mRNA	crooked neck protein, putative / cell cycle protein(AT3G13210)	coding protein	psRNATarget
AK230444.1	ncRNA:21   AUUUGAUGUAAAUAUAUUUUU   1   ||*|=||*||||||||||||| targets:1028   UACAUUAGAUUUAUAUAAAAA   1048 Target Full Sequence	3.0	Arabidopsis thaliana mRNA for crn-like protein, partial sequence., clone: RAFL25-45-P03	NA	coding protein	psRNATarget