ncRNA ID | novel_ath_miR382 |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | Chr2:3804104-3804154 [-] |
Reference genome | TAIR10 |
Source | SRR2135661 |
Length | 23 |
Mature sequence(if miRNA) | 1 - UAGGGUUUAGAGUUUAGGGUAUA - 23 |
Stem-loop(if miRNA) |
--                      A   UACCCUAAACUCUAAACUCUGA G   |||||||||||||||||||||| G   AUGGGAUUUGAGAUUUGGGAUU G AU                      U |
Stem-loop sequence | UACCCUAAACUCUAAACUCUGAAGGGUUUAGGGUUUAGAGUUUAGGGUAUA |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
NM_103829.3 |
|
3.0 | Arabidopsis thaliana 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein mRNA | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein(AT1G49390) | coding protein | psRNATarget | |||||||||
NM_001333381.1 |
|
3.0 | Arabidopsis thaliana 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein mRNA | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein(AT1G49390) | coding protein | psRNATarget |