Search result

BaseInfo

ncRNA ID	novel_ath_miR373
Species	Arabidopsis thaliana
Class	miRNA
Genome position	Chr5:23988485-23988587 [+]
Reference genome	TAIR10
Source	SRR2135660
Length	21
Mature sequence(if miRNA)	1 - GCAGCACCAUUAAGAUUCACA - 21
Stem-loop(if miRNA)	--      C           A  AGA    U  UU     ---   -UU   C   GCAGCA CAUUAAGAUUC CA   GAUG GG  CCCUU   UGC   UCG C   |||||| ||||||||||| ||   |||| ||  |||||   |||   ||| U   CGUCGU GUAGUUCUAAG GU   CUAU CC  GGGAA   ACG   AGC C UA      A           G  GAG    U  UU     AAG   CCU   U
Stem-loop sequence	GCAGCACCAUUAAGAUUCACAAGAGAUGUGGUUCCCUUUGCUUUCGCCUCUCGAUCCGCAGAAAAGGGUUCCUUAUCGAGUGGGAAUCUUGAUGAUGCUGCAU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
BX820988.1	ncRNA:21   ACACUUAGAAUUACCACGACG   1   *|*|||||||*|||||||||| targets:1671   CGAGAAUCUUUAUGGUGCUGC   1691 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH89ZF10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
U52851.2	ncRNA:21   ACACUUAGAAUUACCACGACG   1   *|*|||||||*|||||||||| targets:1636   CGAGAAUCUUUAUGGUGCUGC   1656 Target Full Sequence	2.5	Arabidopsis thaliana arginine decarboxylase (ARGdc) mRNA, complete cds	NA	coding protein	psRNATarget
BT008636.1	ncRNA:21   ACACUUAGAAUUACCACGACG   1   *|*|||||||*|||||||||| targets:1689   CGAGAAUCUUUAUGGUGCUGC   1709 Target Full Sequence	2.5	Arabidopsis thaliana clone RAFL09-94-E10 (R19735) putative arginine decarboxylase (At2g16500) mRNA, complete cds	NA	coding protein	psRNATarget
NM_127204.3	ncRNA:21   ACACUUAGAAUUACCACGACG   1   *|*|||||||*|||||||||| targets:1780   CGAGAAUCUUUAUGGUGCUGC   1800 Target Full Sequence	2.5	Arabidopsis thaliana arginine decarboxylase 1 (ADC1), mRNA	arginine decarboxylase 1(ADC1)	coding protein	psRNATarget