ncRNA ID | novel_ath_miR365 |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | Chr1:17216300-17216373 [+] |
Reference genome | TAIR10 |
Source | SRR2135660 |
Length | 24 |
Mature sequence(if miRNA) | 1 - AUUUGUUGGAAUAUGAUCGUUGGA - 24 |
Stem-loop(if miRNA) |
--       G  A     U    ----GG        AU   AUUUGUU GA UAUGA CGUU      AAAUUUGC  U   ||||||| || ||||| ||||      ||||||||  U   UAAAUGA CU AUAUU GCAA      UUUAAACG  G AG       G  -     U    AGGUUA        CU |
Stem-loop sequence | AUUUGUUGGAAUAUGAUCGUUGGAAAUUUGCAUUUGUCGCAAAUUUAUUGGAAACGUUUAUAUCGAGUAAAUGA |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
BX828888.1 |
|
3.0 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL47ZG06 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
NM_148233.1 |
|
3.0 | Arabidopsis thaliana Eukaryotic aspartyl protease family protein partial mRNA | Eukaryotic aspartyl protease family protein(AT4G04985) | coding protein | psRNATarget |