Search result

BaseInfo

ncRNA ID	novel_ath_miR319
Species	Arabidopsis thaliana
Class	miRNA
Genome position	Chr5:17518977-17519082 [-]
Reference genome	TAIR10
Source	SRR2135657
Length	24
Mature sequence(if miRNA)	1 - AGACAAGGUGAAGAAGAGGAAUGA - 24
Stem-loop(if miRNA)	--AC  A                  --     UUGU   UG  ---G  G  GAGG     UC UCUUCUUCACCUUGUCUU  AGAGG    GUU  GU    UU GU    G     || ||||||||||||||||||  |||||    |||  ||    || ||     AG AGAAGAAGUGGAACAGAA  UCUCU    CGG  CA    AA UA    A AGUA  G                  AU     -GUU   GU  AAAA  G  GAGG
Stem-loop sequence	ACUCAUCUUCUUCACCUUGUCUUAGAGGUUGUGUUUGGUGUUGGUGAGGGAGGAGAUGAAAAAAACUGGGCUUGUCUCUUAAAGACAAGGUGAAGAAGAGGAAUGA

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_123727.2	ncRNA:24   AGUAAGGAGAAGAAGUGGAACAGA   1   |||||||||||||||||||||||| targets:100   UCAUUCCUCUUCUUCACCUUGUCU   123 Target Full Sequence	0.0	Arabidopsis thaliana sucrose-proton symporter 6 (SUC6), mRNA	sucrose-proton symporter 6(SUC6)	coding protein	psRNATarget
NM_105328.3	ncRNA:24   AGUAAGGAGAAGAAGUGGAACAGA   1   |||||=|||||||*|||||||||| targets:100   UCAUUUCUCUUCUCCACCUUGUCU   123 Target Full Sequence	2.5	Arabidopsis thaliana sucrose-proton symporter 7 (SUC7), mRNA	sucrose-proton symporter 7(SUC7)	coding protein	psRNATarget
NM_001036164.2	ncRNA:24   AGUAAGGAGAAGAAGUGGAACAGA   1   |||||=|||||||*|||||||||| targets:100   UCAUUUCUCUUCUCCACCUUGUCU   123 Target Full Sequence	2.5	Arabidopsis thaliana sucrose-proton symporter 7 (SUC7), mRNA	sucrose-proton symporter 7(SUC7)	coding protein	psRNATarget
NM_120549.3	ncRNA:24   AGUA--AGGAGAAGAAGUGGAACAGA   1   ||||--||=|||||||||||*||||| targets:198   UCAUCUUCUUCUUCUUCACCAUGUCU   223 Target Full Sequence	2.5	Arabidopsis thaliana Enhancer of polycomb-like transcription factor protein mRNA	Enhancer of polycomb-like transcription factor protein(AT5G04670)	coding protein	psRNATarget