Search result

BaseInfo

ncRNA ID	novel_ath_miR219
Species	Arabidopsis thaliana
Class	miRNA
Genome position	Chr3:10496334-10496385 [+]
Reference genome	TAIR10
Source	SRR1986039
Length	20
Mature sequence(if miRNA)	1 - GAGGAACUGGAGACGCGAGA - 20
Stem-loop(if miRNA)	--      CU  A         CCCC   GAGGAA  GG GACGCGAGA    C   ||||||  || |||||||||    U   CUUCUU  CC CUGUGCUCU    C CU      AU  -         UUUU
Stem-loop sequence	GAGGAACUGGAGACGCGAGACCCCCUCUUUUUCUCGUGUCCCUAUUCUUCUC

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_119785.4	ncRNA:20   AGAGCGCAGAGGUCAAGGAG   1   **|||*|||||||||||||= targets:639   CAUCGAGUCUCCAGUUCCUU   658 Target Full Sequence	3.0	Arabidopsis thaliana Leucine-rich receptor-like protein kinase family protein mRNA	Leucine-rich receptor-like protein kinase family protein(AT4G36180)	coding protein	psRNATarget
BX826731.1	ncRNA:20   AGAGCGCAGAGGUCAAGGAG   1   **|||*|||||||||||||= targets:487   CAUCGAGUCUCCAGUUCCUU   506 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB58ZF05 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
FJ708764.1	ncRNA:20   AGAGCGCAGAGGUCAAGGAG   1   **|||*|||||||||||||= targets:482   CAUCGAGUCUCCAGUUCCUU   501 Target Full Sequence	3.0	Arabidopsis thaliana leucine-rich repeat receptor-like protein kinase (LRR-RLK) mRNA, partial cds	NA	coding protein	psRNATarget
NM_106553.5	ncRNA:20   AGAGCGCAGAGGUCAAGGAG   1   |||||**||||||||||||* targets:999   UCUCGGCUCUCCAGUUCCUG   1018 Target Full Sequence	3.0	Arabidopsis thaliana Enhancer of polycomb-like transcription factor protein mRNA	Enhancer of polycomb-like transcription factor protein(AT1G79020)	coding protein	psRNATarget
AK117445.1	ncRNA:20   AGAGCGCAGAGGUCAAGGAG   1   |||||**||||||||||||* targets:837   UCUCGGCUCUCCAGUUCCUG   856 Target Full Sequence	3.0	Arabidopsis thaliana At1g79020 mRNA for unknown protein, complete cds, clone: RAFL17-04-P14	NA	coding protein	psRNATarget
BT004983.1	ncRNA:20   AGAGCGCAGAGGUCAAGGAG   1   |||||**||||||||||||* targets:465   UCUCGGCUCUCCAGUUCCUG   484 Target Full Sequence	3.0	Arabidopsis thaliana clone U50567 unknown protein (At1g79020) mRNA, complete cds	NA	coding protein	psRNATarget