| ncRNA ID | novel_ath_miR187 |
| Species | Arabidopsis thaliana |
| Class | miRNA |
| Genome position | Chr3:12673433-12673485 [-] |
| Reference genome | TAIR10 |
| Source | SRR1842775 |
| Length | 24 |
| Mature sequence(if miRNA) | 1 - AGUGUAUGAUUGAGUAUAAGAACU - 24 |
| Stem-loop(if miRNA) |
-- G A - A A UUUUUG AUUCAA UAUG ACU G U |||||| |||||| |||| ||| | AAGAAU UGAGUU GUAU UGA C A UC A A G G U |
| Stem-loop sequence | UUUUUGGAUUCAAAUAUGACUAGAUAUCGAGUGUAUGAUUGAGUAUAAGAACU |
| Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| NM_125027.1 |
|
2.5 | Arabidopsis thaliana F-box/RNI-like/FBD-like domains-containing protein partial mRNA | F-box/RNI-like/FBD-like domains-containing protein(AT5G56440) | coding protein | psRNATarget | |||||||||
| BX814147.1 |
|
2.5 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB59ZC06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget |