ncRNA ID | novel_ath_miR170 |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | Chr5:11512195-11512310 [+] |
Reference genome | TAIR10 |
Source | SRR1842774;SRR1164378;SRR1164382;SRR1164434 |
Length | 24 |
Mature sequence(if miRNA) | 93 - UUUUGAUAGCCUGAAGUUGAGAGC - 116 |
Stem-loop(if miRNA) |
--   UG      --    UG   U      ---GA     UC  ---   AG      GAA   UCU  AUUUUA  UUAU  AGA AAUGUU     UUUGA  GU   ACA  UGUUUU   A   |||  ||||||  ||||  ||| ||||||     |||||  ||   |||  ||||||   U   AGA  UGAAGU  GAUA  UUU UUGCGA     AAACU  CG   UGU  AUAAAA   A CG   GU      CC    GU   -      GAUUG     UC  UUU   GA      GAU |
Stem-loop sequence | UCUUGAUUUUAUUAUUGAGAUAAUGUUGAUUUGAUCGUACAAGUGUUUUGAAAUAUAGAAAAUAAGUGUUUUGCCUUCAAAGUUAGAGCGUUUUUUGAUAGCCUGAAGUUGAGAGC |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
AK228546.1 |
|
0.0 | Arabidopsis thaliana mRNA for hypothetical protein, partial cds, clone: RAFL15-27-L07 | NA | coding protein | psRNATarget | |||||||||
BX831997.1 |
|
0.0 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH45ZB01 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget | |||||||||
AK229846.1 |
|
0.0 | Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL22-04-L09 | NA | coding protein | psRNATarget |