Search result

BaseInfo

ncRNA ID	novel_ath_miR123
Species	Arabidopsis thaliana
Class	miRNA
Genome position	Chr1:7058208-7058299 [+]
Reference genome	TAIR10
Source	SRR1569250;SRR1163718;SRR1265998;SRR1266862
Length	20
Mature sequence(if miRNA)	1 - UUGGCAUUCUGUCCACCUCC - 20
Stem-loop(if miRNA)	--      U C GU            -A     -AU          A   UUGGCA U U  CCACCUCCUUCU  UACAU   AUGCAUGUGU U   |||||| | |  ||||||||||||  |||||   ||||||||||   AACCGU A A  GGUGGAGGAAGA  GUGUG   UGCGUAUAUA A AU      C U UG            AA     CUU          U
Stem-loop sequence	UUGGCAUUCUGUCCACCUCCUUCUAUACAUAUAUGCAUGUGUAUAUAUAUAUGCGUUUCGUGUGAAAGAAGGAGGUGGGUAUACUGCCAAUA

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
BT025325.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1152   GGAGGUUGACAGAAUGCCAA   1171 Target Full Sequence	1.0	Arabidopsis thaliana At1g27340 mRNA, complete cds	NA	coding protein	psRNATarget
AY085471.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1233   GGAGGUUGACAGAAUGCCAA   1252 Target Full Sequence	1.0	Arabidopsis thaliana clone 153013 mRNA, complete sequence	NA	coding protein	psRNATarget
BX815904.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1287   GGAGGUUGACAGAAUGCCAA   1306 Target Full Sequence	1.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH16ZB06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX816952.1	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1375   GGAGGUUGACAGAAUGCCAA   1394 Target Full Sequence	1.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH78ZD04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
NM_102496.4	ncRNA:20   CCUCCACCUGUCUUACGGUU   1   ||||||*||||||||||||| targets:1549   GGAGGUUGACAGAAUGCCAA   1568 Target Full Sequence	1.0	Arabidopsis thaliana Galactose oxidase/kelch repeat superfamily protein (LCR), mRNA	Galactose oxidase/kelch repeat superfamily protein(LCR)	coding protein	psRNATarget