Search result

BaseInfo

ncRNA ID	novel_ath_miR120
Species	Arabidopsis thaliana
Class	miRNA
Genome position	Chr1:22930093-22930175 [-]
Reference genome	TAIR10
Source	SRR1569250;SRR2135661
Length	21
Mature sequence(if miRNA)	1 - UUGAGCCGUGCCAAUAUCACG - 21
Stem-loop(if miRNA)	--A        UG             -      UAC     UG    GAUAUUGG  CGGUUCAAUCAGA AAACCG   UCUUU  U    ||||||||  ||||||||||||| ||||||   |||||    CUAUAACC  GCCGAGUUAGUUU UUUGGC   AGAAA  U GCA        GU             A      --U     UU
Stem-loop sequence	AGAUAUUGGUGCGGUUCAAUCAGAAAACCGUACUCUUUUGUUUUAAAGAUCGGUUUAUUUGAUUGAGCCGUGCCAAUAUCACG

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
AF036303.1	ncRNA:21   GCACUAUAACCGUGCCGAGUU   1   *|*|||||||||=|||||||| targets:132   GGGGAUAUUGGCGCGGCUCAA   152 Target Full Sequence	2.5	Arabidopsis thaliana scarecrow-like 6 (SCL6) mRNA, partial cds	NA	coding protein	psRNATarget
BX820692.1	ncRNA:21   GCACUAUAACCGUGCCGAGUU   1   *|*|||||||||=|||||||| targets:298   AGGGAUAUUGGCGCGGCUCAA   318 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH60ZB03 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY133537.1	ncRNA:21   GCACUAUAACCGUGCCGAGUU   1   *|*|||||||||=|||||||| targets:672   GGGGAUAUUGGCGCGGCUCAA   692 Target Full Sequence	2.5	Arabidopsis thaliana At4g00150/F6N15_20 mRNA, complete cds	NA	coding protein	psRNATarget
BX826491.1	ncRNA:21   GCACUAUAACCGUGCCGAGUU   1   *|*|||||||||=|||||||| targets:658   GGGGAUAUUGGCGCGGCUCAA   678 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB30ZC05 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX827001.1	ncRNA:21   GCACUAUAACCGUGCCGAGUU   1   *|*|||||||||=|||||||| targets:639   GGGGAUAUUGGCGCGGCUCAA   659 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB85ZC09 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BX826648.1	ncRNA:21   GCACUAUAACCGUGCCGAGUU   1   *|*|||||||||=|||||||| targets:734   GGGGAUAUUGGCGCGGCUCAA   754 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB50ZC05 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY096372.1	ncRNA:21   GCACUAUAACCGUGCCGAGUU   1   *|*|||||||||=|||||||| targets:801   AGGGAUAUUGGCGCGGCUCAA   821 Target Full Sequence	2.5	Arabidopsis thaliana putative scarecrow protein (At3g60630) mRNA, complete cds	NA	coding protein	psRNATarget
BT053760.1	ncRNA:21   GCACUAUAACCGUGCCGAGUU   1   *|*|||||||||=|||||||| targets:882   AGGGAUAUUGGCGCGGCUCAA   902 Target Full Sequence	2.5	Arabidopsis thaliana unknown protein (At2g45160) mRNA, complete cds	NA	coding protein	psRNATarget
BT020591.1	ncRNA:21   GCACUAUAACCGUGCCGAGUU   1   *|*|||||||||=|||||||| targets:901   AGGGAUAUUGGCGCGGCUCAA   921 Target Full Sequence	2.5	Arabidopsis thaliana At2g45160 gene, complete cds	NA	coding protein	psRNATarget
AF462831.1	ncRNA:21   GCACUAUAACCGUGCCGAGUU   1   *|*|||||||||=|||||||| targets:755   GGGGAUAUUGGCGCGGCUCAA   775 Target Full Sequence	2.5	Arabidopsis thaliana AT4g00150/F6N15_20 mRNA, complete cds	NA	coding protein	psRNATarget
BX819093.1	ncRNA:21   GCACUAUAACCGUGCCGAGUU   1   *|*|||||||||=|||||||| targets:933   AGGGAUAUUGGCGCGGCUCAA   953 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB45ZE06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY064062.1	ncRNA:21   GCACUAUAACCGUGCCGAGUU   1   *|*|||||||||=|||||||| targets:943   AGGGAUAUUGGCGCGGCUCAA   963 Target Full Sequence	2.5	Arabidopsis thaliana putative scarecrow protein (At3g60630) mRNA, complete cds	NA	coding protein	psRNATarget
BX823015.1	ncRNA:21   GCACUAUAACCGUGCCGAGUU   1   *|*|||||||||=|||||||| targets:1041   AGGGAUAUUGGCGCGGCUCAA   1061 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB80ZC11 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
BT004053.1	ncRNA:21   GCACUAUAACCGUGCCGAGUU   1   *|*|||||||||=|||||||| targets:1000   AGGGAUAUUGGCGCGGCUCAA   1020 Target Full Sequence	2.5	Arabidopsis thaliana clone RAFL15-13-A09 (R20463) putative SCARECROW gene regulator (At2g45160) mRNA, complete cds	NA	coding protein	psRNATarget
NM_116232.5	ncRNA:21   GCACUAUAACCGUGCCGAGUU   1   *|*|||||||||=|||||||| targets:1062   GGGGAUAUUGGCGCGGCUCAA   1082 Target Full Sequence	2.5	Arabidopsis thaliana GRAS family transcription factor (HAM3), mRNA	GRAS family transcription factor(HAM3)	coding protein	psRNATarget
NM_115927.5	ncRNA:21   GCACUAUAACCGUGCCGAGUU   1   *|*|||||||||=|||||||| targets:1097   AGGGAUAUUGGCGCGGCUCAA   1117 Target Full Sequence	2.5	Arabidopsis thaliana GRAS family transcription factor (HAM2), mRNA	GRAS family transcription factor(HAM2)	coding protein	psRNATarget
NM_130079.3	ncRNA:21   GCACUAUAACCGUGCCGAGUU   1   *|*|||||||||=|||||||| targets:1301   AGGGAUAUUGGCGCGGCUCAA   1321 Target Full Sequence	2.5	Arabidopsis thaliana GRAS family transcription factor (HAM1), mRNA	GRAS family transcription factor(HAM1)	coding protein	psRNATarget