Search result

BaseInfo

ncRNA ID	ath-miRf10444-npr
Species	Arabidopsis thaliana
Class	miRNA
Genome position	NA
Reference genome	NA
Source	PNRD
Length	20
Mature sequence(if miRNA)	NA - UAUAGUUGGGUCACAGCCAC - NA
Stem-loop(if miRNA)	-     -       G UU  U   UUU  G      --G UU   -UUUC   G AGGUU CUGUG UUGUGAU U  CU AUA   UU GUCUUU   U  UGU     UCA G ||||| ||||| ||||||| |  || |||   || ||||||   |  |||     ||| UCCAA GACAC GACACUG G  GA UAU   AA UAGAGA   G  ACA     AGU U      A     C       G UU  -   -UC  G      AUA UU   UAUCA   A
Stem-loop sequence	AGGUUCUGUGUUGUGAUGUUUCUUAUAUUUUUGGUCUUUGUUUUGUUUUCUCAGGUAUGAACUAUACAUUGAUAAGAGAUGAACUUAUAGUUGGGUCACAGCCACAGAAACCU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
AK221908.1	ncRNA:20   CACCGACACUGGGUUGAUAU   1   |*||||||||||||||||*| targets:1943   GAGGCUGUGACCCAACUACA   1962 Target Full Sequence	2.5	Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL22-34-N19	NA	coding protein	psRNATarget
NM_201930.1	ncRNA:20   CACCGACACUGGGUUGAUAU   1   |*||||||||||||||||*| targets:3602   GAGGCUGUGACCCAACUACA   3621 Target Full Sequence	2.5	Arabidopsis thaliana Heat shock protein DnaJ with tetratricopeptide repeat-containing protein (TPR15), mRNA	Heat shock protein DnaJ with tetratricopeptide repeat-containing protein(TPR15)	coding protein	psRNATarget
AY062588.1	ncRNA:20   CACCGACACUGGGUUGAUAU   1   |*||||||||||||||||*| targets:3695   GAGGCUGUGACCCAACUACA   3714 Target Full Sequence	2.5	Arabidopsis thaliana Unknown protein (At2g41520; T32G6.4) mRNA, complete cds	NA	coding protein	psRNATarget
NM_001336923.1	ncRNA:20   CACCGACACUGGGUUGAUAU   1   |*||||||||||||||||*| targets:3708   GAGGCUGUGACCCAACUACA   3727 Target Full Sequence	2.5	Arabidopsis thaliana Heat shock protein DnaJ with tetratricopeptide repeat-containing protein (TPR15), mRNA	Heat shock protein DnaJ with tetratricopeptide repeat-containing protein(TPR15)	coding protein	psRNATarget
NM_180020.4	ncRNA:20   CACCGACACUGGGUUGAUAU   1   |*||||||||||||||||*| targets:3713   GAGGCUGUGACCCAACUACA   3732 Target Full Sequence	2.5	Arabidopsis thaliana Heat shock protein DnaJ with tetratricopeptide repeat-containing protein (TPR15), mRNA	Heat shock protein DnaJ with tetratricopeptide repeat-containing protein(TPR15)	coding protein	psRNATarget