Search result

BaseInfo

ncRNA ID	novel_ath_miR79
Species	Arabidopsis thaliana
Class	miRNA
Genome position	Chr1:18640839-18640919 [+]
Reference genome	TAIR10
Source	SRR1560126
Length	24
Mature sequence(if miRNA)	1 - AAAGGGUCCUUGAGAGUUUUGAGC - 24
Stem-loop(if miRNA)	--        C    -  GU     ----------    A     A   AAAGGGUC UUGA GA  UUUGA          GCCA AAGCA A   |||||||| |||| ||  |||||          |||| |||||   UUUCUCAG AGCU UU  AAACU          UGGU UUCGU G AC        C    A  UG     AGAGUGUUCA    A     A
Stem-loop sequence	AAAGGGUCCUUGAGAGUUUUGAGCCAAAAGCAAAGAUGCUUAUGGUACUUGUGAGAUCAAAGUUUAUCGACGACUCUUUCA

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_127019.4	ncRNA:24   CGAGUUUUGAGAGUUCCUGGGAAA   1   |||||||*||||||||*||||||| targets:1388   GCUCAAACCUCUCAAGAACCCUUU   1411 Target Full Sequence	2.5	Arabidopsis thaliana LURP-one-like protein (DUF567) (LURP1), mRNA	LURP-one-like protein (DUF567)(LURP1)	coding protein	psRNATarget
NM_001335426.1	ncRNA:24   CGAGUUUUGAGAGUUCCUGGGAAA   1   |||||||*||||||||*||||||| targets:1743   GCUCAAACCUCUCAAGAACCCUUU   1766 Target Full Sequence	2.5	Arabidopsis thaliana LURP-one-like protein (DUF567) (LURP1), mRNA	LURP-one-like protein (DUF567)(LURP1)	coding protein	psRNATarget
BX828348.1	ncRNA:24   CGA--GUUUUGAGAGUUCCUGGGAAA   1   |||--||||||*|||=|||||||||| targets:1354   GCUUACAAAACACUCGAGGACCCUUU   1379 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH79ZD06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AB493427.1	ncRNA:24   CGAGUUUUGAGAGUUCCUGGGAAA   1   |*|*||||||=||||||||=|||| targets:81   GGUAAAAACUUUCAAGGACUCUUU   104 Target Full Sequence	2.5	Arabidopsis thaliana At1g03530 mRNA for hypothetical protein, partial cds, clone: RAAt1g03530	NA	coding protein	psRNATarget
BT005807.1	ncRNA:24   CGAGUUUUGAGAGUUCCUGGGAAA   1   |*|*||||||=||||||||=|||| targets:81   GGUAAAAACUUUCAAGGACUCUUU   104 Target Full Sequence	2.5	Arabidopsis thaliana At1g03530 gene, complete cds	NA	coding protein	psRNATarget
AK227993.1	ncRNA:24   CGAGUUUUGAGAGUUCCUGGGAAA   1   |*|*||||||=||||||||=|||| targets:134   GGUAAAAACUUUCAAGGACUCUUU   157 Target Full Sequence	2.5	Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL14-52-L01	NA	coding protein	psRNATarget
NM_100235.4	ncRNA:24   CGAGUUUUGAGAGUUCCUGGGAAA   1   |*|*||||||=||||||||=|||| targets:342   GGUAAAAACUUUCAAGGACUCUUU   365 Target Full Sequence	2.5	Arabidopsis thaliana nuclear assembly factor 1 (NAF1), mRNA	nuclear assembly factor 1(NAF1)	coding protein	psRNATarget
BX819888.1	ncRNA:24   CGAGUUUUGAGAGUUCCUGGGAAA   1   **||=|||*|||||||*||||||| targets:339   CGUCGAAAAUCUCAAGUACCCUUU   362 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS43ZH02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
NM_128225.4	ncRNA:24   CGAGUUUUGAGAGUUCCUGGGAAA   1   **||=|||*|||||||*||||||| targets:477   CGUCGAAAAUCUCAAGUACCCUUU   500 Target Full Sequence	2.5	Arabidopsis thaliana FkbM family methyltransferase mRNA	FkbM family methyltransferase(AT2G26680)	coding protein	psRNATarget