Search result

BaseInfo

ncRNA ID	novel_ath_miR74
Species	Arabidopsis thaliana
Class	miRNA
Genome position	Chr2:7587491-7587565 [-]
Reference genome	TAIR10
Source	SRR1560125
Length	21
Mature sequence(if miRNA)	55 - AAAACAUUCUUCUUUUCGGAU - 75
Stem-loop(if miRNA)	--AAA       U     C                  A      ACAUUCU CUUUU GGAUGUCUAAAAUGUUUU G      ||||||| ||||| ||||||||||||||||||      UGUAAGA GAAAA CCUACAGAUUUUAUAGAA G AUUUC       -     A                  A
Stem-loop sequence	AAAACAUUCUUCUUUUCGGAUGUCUAAAAUGUUUUAGGAAAGAUAUUUUAGACAUCCAAAAAGAGAAUGUCUUUA

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_117271.3	ncRNA:21   UAGGCUUUUCUUCUUACAAAA   1   **|=|||*||||||||||||| targets:1462   CACUGAACAGAAGAAUGUUUU   1482 Target Full Sequence	2.0	Arabidopsis thaliana Disease resistance protein (TIR-NBS-LRR class) family mRNA	Disease resistance protein (TIR-NBS-LRR class) family(AT4G12010)	coding protein	psRNATarget
AK175839.1	ncRNA:21   UAGGCUUUUCUUCUUACAAAA   1   **|=|||*||||||||||||| targets:1308   CACUGAACAGAAGAAUGUUUU   1328 Target Full Sequence	2.0	Arabidopsis thaliana mRNA for putative disease resistance protein (TMV N-like), complete cds, clone: RAFL22-45-H02	NA	coding protein	psRNATarget
AK175963.1	ncRNA:21   UAGGCUUUUCUUCUUACAAAA   1   **|=|||*||||||||||||| targets:1308   CACUGAACAGAAGAAUGUUUU   1328 Target Full Sequence	2.0	Arabidopsis thaliana mRNA for putative disease resistance protein (TMV N-like), complete cds, clone: RAFL22-65-L13	NA	coding protein	psRNATarget
BX826740.1	ncRNA:21   UAGGCUUUUCUUCUUACAAAA   1   **|=|||*||||||||||||| targets:1249   CACUGAACAGAAGAAUGUUUU   1269 Target Full Sequence	2.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB59ZH02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
NM_105024.4	ncRNA:21   UAGGCUUUUCUUCUUACAAAA   1   ****|||=||||||||||||| targets:1697   UAAAGAAGAGAAGAAUGUUUU   1717 Target Full Sequence	3.0	Arabidopsis thaliana root hair specific 8 (RHS8), mRNA	root hair specific 8(RHS8)	coding protein	psRNATarget
KJ138954.1	ncRNA:21   UAGGCUUUUCUUCUUACAAAA   1   ****|||=||||||||||||| targets:414   UAAAGAAGAGAAGAAUGUUUU   434 Target Full Sequence	3.0	Arabidopsis thaliana glycosyltransferase (AT1G63450) mRNA, partial cds	NA	coding protein	psRNATarget
BX816851.1	ncRNA:21   UAGGCUUUUCUUCUUACAAAA   1   ****|||=||||||||||||| targets:184   UAAAGAAGAGAAGAAUGUUUU   204 Target Full Sequence	3.0	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH71ZD12 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AK230135.1	ncRNA:21   UAGGCUUUUCUUCUUACAAAA   1   ****|||=||||||||||||| targets:1528   UAAAGAAGAGAAGAAUGUUUU   1548 Target Full Sequence	3.0	Arabidopsis thaliana mRNA for hypothetical protein, partial cds, clone: RAFL22-82-D21	NA	coding protein	psRNATarget