ncRNA ID | novel_ath_miR70 |
Species | Arabidopsis thaliana |
Class | miRNA |
Genome position | Chr3:6242451-6242511 [+] |
Reference genome | TAIR10 |
Source | SRR1560124 |
Length | 21 |
Mature sequence(if miRNA) | 41 - AAGAUGAAAACGCAAACGCCU - 61 |
Stem-loop(if miRNA) |
--                G  AC    AUU   GCGUUUGUGUUUUCAU UU  AAUG   A   |||||||||||||||| ||  ||||   G   CGCAAACGCAAAAGUA AA  UUAC   A UC                G  CA    AAA |
Stem-loop sequence | GCGUUUGUGUUUUCAUGUUACAAUGAUUAGAAAACAUUACAAGAUGAAAACGCAAACGCCU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
NM_001343391.1 |
|
2.5 | Arabidopsis thaliana Transmembrane amino acid transporter family protein mRNA | Transmembrane amino acid transporter family protein(AT5G15240) | coding protein | psRNATarget | |||||||||
BX813978.1 |
|
3.0 | Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB50ZE08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) | NA | coding protein | psRNATarget |