Search result

BaseInfo

ncRNA ID	novel_ath_miR46
Species	Arabidopsis thaliana
Class	miRNA
Genome position	Chr5:14548613-14548695 [-]
Reference genome	TAIR10
Source	SRR1560122;SRR1560124;SRR1560125
Length	21
Mature sequence(if miRNA)	63 - UAUAUUCAAGUGUUUUGGACU - 83
Stem-loop(if miRNA)	UA          U     UAAAG   UG    ---A   GAG UA  UUCAAGUGUU UGGAC     GAU  AUGA    UUG   A ||  |||||||||| |||||     |||  ||||    |||   U AU  GGGUUUACAA AUCUG     UUA  UAUU    AGC   U   GC          U     -----   GU    AGUG   AGA
Stem-loop sequence	UAUAUUCAAGUGUUUUGGACUAAAGGAUUGAUGAAUUGGAGAUUAGACGAGUGAUUAUUGAUUGUCUAUAACAUUUGGGCGUA

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
NM_001125569.1	ncRNA:21   UCAGGUUUUGUGAACUUAUAU   1   |**|||||||||||*|||||| targets:1199   AAACCAAAACACUUAAAUAUA   1219 Target Full Sequence	2.5	Arabidopsis thaliana acyl-CoA-binding domain 3 (ACBP3), partial mRNA	acyl-CoA-binding domain 3(ACBP3)	coding protein	psRNATarget
BX827803.1	ncRNA:21   UCAGGUUUUGUGAACUUAUAU   1   |**|||||||||||*|||||| targets:1225   AAACCAAAACACUUAAAUAUA   1245 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH23ZC04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
NM_001084971.1	ncRNA:21   UCAGGUUUUGUGAACUUAUAU   1   |**|||||||||||*|||||| targets:1213   AAACCAAAACACUUAAAUAUA   1233 Target Full Sequence	2.5	Arabidopsis thaliana acyl-CoA-binding domain 3 (ACBP3), mRNA	acyl-CoA-binding domain 3(ACBP3)	coding protein	psRNATarget
BX828845.1	ncRNA:21   UCAGGUUUUGUGAACUUAUAU   1   |**|||||||||||*|||||| targets:1280   AAACCAAAACACUUAAAUAUA   1300 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL43ZH08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AK227063.1	ncRNA:21   UCAGGUUUUGUGAACUUAUAU   1   |**|||||||||||*|||||| targets:1280   AAACCAAAACACUUAAAUAUA   1300 Target Full Sequence	2.5	Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL09-62-D11	NA	coding protein	psRNATarget
NM_001084970.1	ncRNA:21   UCAGGUUUUGUGAACUUAUAU   1   |**|||||||||||*|||||| targets:1209   AAACCAAAACACUUAAAUAUA   1229 Target Full Sequence	2.5	Arabidopsis thaliana acyl-CoA-binding domain 3 (ACBP3), mRNA	acyl-CoA-binding domain 3(ACBP3)	coding protein	psRNATarget
BX827494.1	ncRNA:21   UCAGGUUUUGUGAACUUAUAU   1   |**|||||||||||*|||||| targets:1209   AAACCAAAACACUUAAAUAUA   1229 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS64ZF06 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AK317000.1	ncRNA:21   UCAGGUUUUGUGAACUUAUAU   1   |**|||||||||||*|||||| targets:1316   AAACCAAAACACUUAAAUAUA   1336 Target Full Sequence	2.5	Arabidopsis thaliana AT4G24230 mRNA, complete cds, clone: RAFL16-87-K14	NA	coding protein	psRNATarget
NM_118556.4	ncRNA:21   UCAGGUUUUGUGAACUUAUAU   1   |**|||||||||||*|||||| targets:1304   AAACCAAAACACUUAAAUAUA   1324 Target Full Sequence	2.5	Arabidopsis thaliana acyl-CoA-binding domain 3 (ACBP3), mRNA	acyl-CoA-binding domain 3(ACBP3)	coding protein	psRNATarget
NM_179101.3	ncRNA:21   UCAGGUUUUGUGAACUUAUAU   1   |**|||||||||||*|||||| targets:1305   AAACCAAAACACUUAAAUAUA   1325 Target Full Sequence	2.5	Arabidopsis thaliana acyl-CoA-binding domain 3 (ACBP3), mRNA	acyl-CoA-binding domain 3(ACBP3)	coding protein	psRNATarget