Search result

BaseInfo

ncRNA ID	novel_ath_miR7
Species	Arabidopsis thaliana
Class	miRNA
Genome position	Chr5:8594675-8594738 [-]
Reference genome	TAIR10
Source	SRR1560118;SRR1560119;SRR1560120;SRR1560122;SRR1560126;SRR1560127;SRR1560128;SRR1560129;SRR1569248;SRR1569249;SRR1569250;SRR1569251;SRR1842774;SRR1842775;SRR2145249;SRR2145250;SRR2145251;ERR1337928;SRR3048747;SRR3048748;SRR3048749;ERR1337929;SRR3144591;ERR1337930;SRR3222444;SRR3222445;ERR1337931;ERR562732;ERR562741;ERR562745;ERR562746;SRR1163504;SRR1163720;SRR1164382;SRR1164433;SRR1164434;SRR1265987;SRR1265989;SRR1266001;SRR1266859;SRR1266861;SRR1266862;SRR1266863;SRR1266864;SRR1266865;SRR1266866;SRR1266867;SRR1266868;SRR1266869;SRR1266870;SRR1266871;SRR1312904;SRR1312905
Length	22
Mature sequence(if miRNA)	43 - UUCUGUAGACCCAUCAUACCUU - 64
Stem-loop(if miRNA)	--     U   C    C         AAAA      UUCUG AGA CCAU AUACCUUCG    CAUA   ||||| ||| |||| |||||||||    |||G   AAGAU UUU GGUA UAUGGAAGC    GUAC CC     C   A    -         --AG
Stem-loop sequence	UUCUGUAGACCCAUCAUACCUUCGAAAACAUAGCAUGGACGAAGGUAUAUGGAUUUCUAGAACC

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
BX833785.1	ncRNA:22   UUCCAUACUACCCAGAUGUCUU   1   |=|||*|||||||||*|||||| targets:142   AGGGUUUGAUGGGUCGACAGAA   163 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL77ZA04 of Silique of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AY045960.1	ncRNA:22   UUCCAUACUACCCAGAUGUCUU   1   |=|||*|||||||||*|||||| targets:177   AGGGUUUGAUGGGUCGACAGAA   198 Target Full Sequence	2.5	Arabidopsis thaliana putative cellulose synthase catalytic subunit (At5g05170) mRNA, partial cds	NA	coding protein	psRNATarget
BX833092.1	ncRNA:22   UUCCAUACUACCCAGAUGUCUU   1   |=|||*|||||||||*|||||| targets:306   AGGGUUUGAUGGGUCGACAGAA   327 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL33ZG12 of Silique of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
AK230097.1	ncRNA:22   UUCCAUACUACCCAGAUGUCUU   1   |=|||*|||||||||*|||||| targets:1144   AGGGUUUGAUGGGUCGACAGAA   1165 Target Full Sequence	2.5	Arabidopsis thaliana mRNA for cellulose synthase catalytic subunit, partial cds, clone: RAFL22-74-N24	NA	coding protein	psRNATarget
KJ138704.1	ncRNA:22   UUCCAUACUACCCAGAUGUCUU   1   |=|||*|||||||||*|||||| targets:3044   AGGGUUUGAUGGGUCGACAGAA   3065 Target Full Sequence	2.5	Arabidopsis thaliana glycosyltransferase (AT5G05170) mRNA, partial cds	NA	coding protein	psRNATarget
BT002335.1	ncRNA:22   UUCCAUACUACCCAGAUGUCUU   1   |=|||*|||||||||*|||||| targets:3044   AGGGUUUGAUGGGUCGACAGAA   3065 Target Full Sequence	2.5	Arabidopsis thaliana clone C104938 putative cellulose synthase catalytic subunit (At5g05170) mRNA, complete cds	NA	coding protein	psRNATarget
AF027174.2	ncRNA:22   UUCCAUACUACCCAGAUGUCUU   1   |=|||*|||||||||*|||||| targets:3213   AGGGUUUGAUGGGUCGACAGAA   3234 Target Full Sequence	2.5	Arabidopsis thaliana cellulose synthase catalytic subunit (Ath-B) mRNA, complete cds	NA	coding protein	psRNATarget
NM_120599.4	ncRNA:22   UUCCAUACUACCCAGAUGUCUU   1   |=|||*|||||||||*|||||| targets:3402   AGGGUUUGAUGGGUCGACAGAA   3423 Target Full Sequence	2.5	Arabidopsis thaliana Cellulose synthase family protein (CEV1), mRNA	Cellulose synthase family protein(CEV1)	coding protein	psRNATarget