Search result

BaseInfo

ncRNA ID	ath-miR161.1
Species	Arabidopsis thaliana
Class	miRNA
Genome position	chr1:17825685-17825857 [+]
Reference genome	TAIR10
Source	miRBase
Length	21
Mature sequence(if miRNA)	47 - UGAAAGUGACUACAUCGGGGU - 67
Stem-loop(if miRNA)	U    GA    GG      AC   UUUAU     C   C      U            C         CC    UUUU     ----        GCUU  UCUC  UUUUUG  CAG     UGCGU GAU AAUGCA UGAAAGUGACUA AUCGGGGUU  GAUU    UUGUU    CUUCAUA  ||||  ||||  ||||||  |||     ||||| ||| |||||| |||||||||||| |||||||||  ||||    |||||    ||||||U  CGAA  AGGG  AAAAAU  GUU     ACGUA CUA UUACGU ACUUUCACUGAU UGGUCCCAA  CUAA    GACAA    GAAGUAG A    -A    AG      --   ----U     A   A      C            U         --    ---U     AGGC
Stem-loop sequence	UGCUUGAUCUCGGUUUUUGACCAGUUUAUUGCGUCGAUCAAUGCAUUGAAAGUGACUACAUCGGGGUUCCGAUUUUUUUUGUUCUUCAUAUGAUGAAGCGGAAACAGUAAUCAACCCUGGUUUAGUCACUUUCACUGCAUUAAUCAAUGCAUUUGUAAAAAGAGGGAAAAGCA

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
AY056104.1	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   |=||**||||||||||||||| targets:945   AUCCAAAUGUAGUCACUUUCA   965 Target Full Sequence	2.0	Arabidopsis thaliana At1g62930/F16P17_26 mRNA sequence	NA	coding protein	psRNATarget
NM_104971.3	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   |=||**||||||||||||||| targets:965   AUCCAAAUGUAGUCACUUUCA   985 Target Full Sequence	2.0	Arabidopsis thaliana Tetratricopeptide repeat (TPR)-like superfamily protein (RPF3), partial mRNA	Tetratricopeptide repeat (TPR)-like superfamily protein(RPF3)	coding protein	psRNATarget
NM_001334064.1	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   |=||**||||||||||||||| targets:1008   AUCCAAAUGUAGUCACUUUCA   1028 Target Full Sequence	2.0	Arabidopsis thaliana Pentatricopeptide repeat (PPR) superfamily protein mRNA	Pentatricopeptide repeat (PPR) superfamily protein(AT1G63080)	coding protein	psRNATarget
NM_104969.4	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   |=||**||||||||||||||| targets:1086   AUCCAAAUGUAGUCACUUUCA   1106 Target Full Sequence	2.0	Arabidopsis thaliana Pentatricopeptide repeat (PPR) superfamily protein mRNA	Pentatricopeptide repeat (PPR) superfamily protein(AT1G62910)	coding protein	psRNATarget
BT000125.1	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   |=||**||||||||||||||| targets:968   AUCCAAAUGUAGUCACUUUCA   988 Target Full Sequence	2.0	Arabidopsis thaliana unknown protein (At1g63130) mRNA, complete cds	NA	coding protein	psRNATarget
NM_105019.2	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   |=||**||||||||||||||| targets:1122   AUCCAAAUGUAGUCACUUUCA   1142 Target Full Sequence	2.0	Arabidopsis thaliana Pentatricopeptide repeat (PPR) superfamily protein mRNA	Pentatricopeptide repeat (PPR) superfamily protein(AT1G63400)	coding protein	psRNATarget
AY128387.1	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   |=||**||||||||||||||| targets:1092   AUCCAAAUGUAGUCACUUUCA   1112 Target Full Sequence	2.0	Arabidopsis thaliana unknown protein (At1g63130) mRNA, complete cds	NA	coding protein	psRNATarget
NM_001334067.1	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   |=||**||||||||||||||| targets:1304   AUCCAAAUGUAGUCACUUUCA   1324 Target Full Sequence	2.0	Arabidopsis thaliana Tetratricopeptide repeat (TPR)-like superfamily protein mRNA	Tetratricopeptide repeat (TPR)-like superfamily protein(AT1G63130)	coding protein	psRNATarget
NM_104991.3	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   |=||**||||||||||||||| targets:1304   AUCCAAAUGUAGUCACUUUCA   1324 Target Full Sequence	2.0	Arabidopsis thaliana Tetratricopeptide repeat (TPR)-like superfamily protein mRNA	Tetratricopeptide repeat (TPR)-like superfamily protein(AT1G63130)	coding protein	psRNATarget
NM_001334065.1	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   |=||**||||||||||||||| targets:1030   AUCCAAAUGUAGUCACUUUCA   1050 Target Full Sequence	2.0	Arabidopsis thaliana Pentatricopeptide repeat (PPR) superfamily protein mRNA	Pentatricopeptide repeat (PPR) superfamily protein(AT1G63080)	coding protein	psRNATarget
NM_104986.3	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   |=||**||||||||||||||| targets:1015   AUCCAAAUGUAGUCACUUUCA   1035 Target Full Sequence	2.0	Arabidopsis thaliana Pentatricopeptide repeat (PPR) superfamily protein mRNA	Pentatricopeptide repeat (PPR) superfamily protein(AT1G63080)	coding protein	psRNATarget
AK226724.1	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   |=||**||||||||||||||| targets:1013   AUCCAAAUGUAGUCACUUUCA   1033 Target Full Sequence	2.0	Arabidopsis thaliana mRNA for hypothetical protein, clone: RAFL07-68-O04	NA	coding protein	psRNATarget
NM_001198380.2	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   ||||=|||||*|||||||||| targets:738   ACCCUGAUGUUGUCACUUUCA   758 Target Full Sequence	2.5	Arabidopsis thaliana Tetratricopeptide repeat (TPR)-like superfamily protein mRNA	Tetratricopeptide repeat (TPR)-like superfamily protein(AT1G64583)	coding protein	psRNATarget
NM_001334168.1	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   ||||=|||||*|||||||||| targets:725   ACCCUGAUGUUGUCACUUUCA   745 Target Full Sequence	2.5	Arabidopsis thaliana Tetratricopeptide repeat (TPR)-like superfamily protein mRNA	Tetratricopeptide repeat (TPR)-like superfamily protein(AT1G64583)	coding protein	psRNATarget
NM_104944.1	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   ||||=||||||*||||||||| targets:968   ACCCUGAUGUAUUCACUUUCA   988 Target Full Sequence	2.5	Arabidopsis thaliana rna processing factor 2 (RPF2), partial mRNA	rna processing factor 2(RPF2)	coding protein	psRNATarget
NM_001334047.1	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   ||||=||||||*||||||||| targets:1125   ACCCUGAUGUAUUCACUUUCA   1145 Target Full Sequence	2.5	Arabidopsis thaliana rna processing factor 2 (RPF2), mRNA	rna processing factor 2(RPF2)	coding protein	psRNATarget
NM_001344391.1	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   |*||=||||||*||||||||| targets:621   AACCUGAUGUAAUCACUUUCA   641 Target Full Sequence	2.5	Arabidopsis thaliana Pentatricopeptide repeat (PPR-like) superfamily protein mRNA	Pentatricopeptide repeat (PPR-like) superfamily protein(AT5G41170)	coding protein	psRNATarget
BT023465.1	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   |*||=||||||*||||||||| targets:762   AACCUGAUGUAAUCACUUUCA   782 Target Full Sequence	2.5	Arabidopsis thaliana At5g41170 gene, complete cds	NA	coding protein	psRNATarget
NM_001344390.1	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   |*||=||||||*||||||||| targets:872   AACCUGAUGUAAUCACUUUCA   892 Target Full Sequence	2.5	Arabidopsis thaliana Pentatricopeptide repeat (PPR-like) superfamily protein mRNA	Pentatricopeptide repeat (PPR-like) superfamily protein(AT5G41170)	coding protein	psRNATarget
AK229240.1	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   =|||*||||||*||||||||| targets:864   GCCCGGAUGUAAUCACUUUCA   884 Target Full Sequence	2.5	Arabidopsis thaliana mRNA for hypothetical protein, clone: RAFL16-52-L06	NA	coding protein	psRNATarget
NM_001331634.1	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   =|||*||||||*||||||||| targets:887   GCCCGGAUGUAAUCACUUUCA   907 Target Full Sequence	2.5	Arabidopsis thaliana Pentatricopeptide repeat (PPR) superfamily protein mRNA	Pentatricopeptide repeat (PPR) superfamily protein(AT1G06580)	coding protein	psRNATarget
NM_001331633.1	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   =|||*||||||*||||||||| targets:890   GCCCGGAUGUAAUCACUUUCA   910 Target Full Sequence	2.5	Arabidopsis thaliana Pentatricopeptide repeat (PPR) superfamily protein mRNA	Pentatricopeptide repeat (PPR) superfamily protein(AT1G06580)	coding protein	psRNATarget
NM_123482.3	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   |*||=||||||*||||||||| targets:872   AACCUGAUGUAAUCACUUUCA   892 Target Full Sequence	2.5	Arabidopsis thaliana Pentatricopeptide repeat (PPR-like) superfamily protein mRNA	Pentatricopeptide repeat (PPR-like) superfamily protein(AT5G41170)	coding protein	psRNATarget
BX832046.1	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   |*||=||||||*||||||||| targets:872   AACCUGAUGUAAUCACUUUCA   892 Target Full Sequence	2.5	Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH48ZF12 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress)	NA	coding protein	psRNATarget
NM_100537.4	ncRNA:21   UGGGGCUACAUCAGUGAAAGU   1   =|||*||||||*||||||||| targets:1083   GCCCGGAUGUAAUCACUUUCA   1103 Target Full Sequence	2.5	Arabidopsis thaliana Pentatricopeptide repeat (PPR) superfamily protein mRNA	Pentatricopeptide repeat (PPR) superfamily protein(AT1G06580)	coding protein	psRNATarget

Reference

1	PMID:12101121 "MicroRNAs in plants"; Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP; Genes Dev. 16:1616-1626(2002).
2	PMID:12202040 "Prediction of plant microRNA targets"; Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP; Cell. 110:513-520(2002).
3	PMID:16040653 "Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005).
4	PMID:17182867 "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006).
5	PMID:16954541 "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006).
6	PMID:18542052 "Global identification of microRNA-target RNA pairs by parallel analysis of RNA ends"; German MA, Pillay M, Jeong DH, Hetawal A, Luo S, Janardhanan P, Kannan V, Rymarquis LA, Nobuta K, German R, De Paoli E, Lu C, Schroth G, Meyers BC, Green PJ; Nat Biotechnol. 26:941-946(2008).
7	PMID:19815687 "Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010).