Search result

BaseInfo

ncRNA ID	zma-miR166c-5p
Species	Zea mays
Class	miRNA
Genome position	chr4:150406705-150406796 [+]
Reference genome	RefGen_v2
Source	miRBase
Length	21
Mature sequence(if miRNA)	3 - GGAAUGUUGUCUGGCUCGAGG - 23
Stem-loop(if miRNA)	UU      CU      --    A   -ACGCA       GGGGAAUG  GUCUGG  CGAGGU  GCAG AAC      GAUCUCA ||||||||  ||||||  ||||||  |||| |||      ||||||U CCCCUUAC  CGGACC  GCUCUA  UGUU UUG      CUGGAGC         UU      AG      GU    G   GUUCUG
Stem-loop sequence	GGGGAAUGUUGUCUGGCUCGAGGUGCAGAAACACGCAGAUCUCAUCGAGGUCGUCUUGGUUGUUGUUGAUCUCGGACCAGGCUUCAUUCCCC

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
LQ240793.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   ||||||||||||||||||||| targets:75   CCUCGAGCCAGACAACAUUCC   95 Target Full Sequence	0.0	Sequence 6788 from Patent EP2985353	NA	coding protein	psRNATarget
LQ235238.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   ||||||||||||||||||||| targets:75   CCUCGAGCCAGACAACAUUCC   95 Target Full Sequence	0.0	Sequence 1233 from Patent EP2985353	NA	coding protein	psRNATarget
LQ235540.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   ||||||||||||||||||||| targets:75   CCUCGAGCCAGACAACAUUCC   95 Target Full Sequence	0.0	Sequence 1535 from Patent EP2985353	NA	coding protein	psRNATarget
HI408663.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   ||||||||||||||||||||| targets:75   CCUCGAGCCAGACAACAUUCC   95 Target Full Sequence	0.0	Sequence 6788 from Patent EP2074227	NA	coding protein	psRNATarget
HI403108.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   ||||||||||||||||||||| targets:75   CCUCGAGCCAGACAACAUUCC   95 Target Full Sequence	0.0	Sequence 1233 from Patent EP2074227	NA	coding protein	psRNATarget
JB169124.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   ||||||||||||||||||||| targets:75   CCUCGAGCCAGACAACAUUCC   95 Target Full Sequence	0.0	Sequence 6788 from Patent EP2559767	NA	coding protein	psRNATarget
JB163871.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   ||||||||||||||||||||| targets:75   CCUCGAGCCAGACAACAUUCC   95 Target Full Sequence	0.0	Sequence 1535 from Patent EP2559767	NA	coding protein	psRNATarget
HI403410.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   ||||||||||||||||||||| targets:75   CCUCGAGCCAGACAACAUUCC   95 Target Full Sequence	0.0	Sequence 1535 from Patent EP2074227	NA	coding protein	psRNATarget
JB163569.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   ||||||||||||||||||||| targets:75   CCUCGAGCCAGACAACAUUCC   95 Target Full Sequence	0.0	Sequence 1233 from Patent EP2559767	NA	coding protein	psRNATarget
LQ235617.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   ||||||||||||||||||||= targets:75   CCUCGAGCCAGACAACAUUCU   95 Target Full Sequence	1.0	Sequence 1612 from Patent EP2985353	NA	coding protein	psRNATarget
LQ235313.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   ||||||||||||||||||||= targets:75   CCUCGAGCCAGACAACAUUCU   95 Target Full Sequence	1.0	Sequence 1308 from Patent EP2985353	NA	coding protein	psRNATarget
HI403183.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   ||||||||||||||||||||= targets:75   CCUCGAGCCAGACAACAUUCU   95 Target Full Sequence	1.0	Sequence 1308 from Patent EP2074227	NA	coding protein	psRNATarget
JB163948.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   ||||||||||||||||||||= targets:75   CCUCGAGCCAGACAACAUUCU   95 Target Full Sequence	1.0	Sequence 1612 from Patent EP2559767	NA	coding protein	psRNATarget
HI403487.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   ||||||||||||||||||||= targets:75   CCUCGAGCCAGACAACAUUCU   95 Target Full Sequence	1.0	Sequence 1612 from Patent EP2074227	NA	coding protein	psRNATarget
JB163644.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   ||||||||||||||||||||= targets:75   CCUCGAGCCAGACAACAUUCU   95 Target Full Sequence	1.0	Sequence 1308 from Patent EP2559767	NA	coding protein	psRNATarget
NM_001153310.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   |||||||||||*||||||||| targets:1959   CCUCGAGCCAGCCAACAUUCC   1979 Target Full Sequence	1.5	Zea mays uncharacterized LOC100280385 (LOC100280385), mRNA	NA	coding protein	psRNATarget
NM_001153310.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   |**||||||||||||||*||| targets:1672   CACCGAGCCAGACAACAAUCC   1692 Target Full Sequence	2.5	Zea mays uncharacterized LOC100280385 (LOC100280385), mRNA	NA	coding protein	psRNATarget
BT056134.2	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   |||||||||||*||||||||| targets:1959   CCUCGAGCCAGCCAACAUUCC   1979 Target Full Sequence	1.5	Zea mays full-length cDNA clone ZM_BFb0035E17 mRNA, complete cds	NA	coding protein	psRNATarget
BT056134.2	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   |**||||||||||||||*||| targets:1672   CACCGAGCCAGACAACAAUCC   1692 Target Full Sequence	2.5	Zea mays full-length cDNA clone ZM_BFb0035E17 mRNA, complete cds	NA	coding protein	psRNATarget
LQ235265.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   |||=||*|||||||||||||| targets:104   CCUUGAACCAGACAACAUUCC   124 Target Full Sequence	2.0	Sequence 1260 from Patent EP2985353	NA	coding protein	psRNATarget
JB163904.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   |||=||*|||||||||||||| targets:104   CCUUGAACCAGACAACAUUCC   124 Target Full Sequence	2.0	Sequence 1568 from Patent EP2559767	NA	coding protein	psRNATarget
JB163596.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   |||=||*|||||||||||||| targets:104   CCUUGAACCAGACAACAUUCC   124 Target Full Sequence	2.0	Sequence 1260 from Patent EP2559767	NA	coding protein	psRNATarget
HI403443.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   |||=||*|||||||||||||| targets:104   CCUUGAACCAGACAACAUUCC   124 Target Full Sequence	2.0	Sequence 1568 from Patent EP2074227	NA	coding protein	psRNATarget
HI403135.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   |||=||*|||||||||||||| targets:104   CCUUGAACCAGACAACAUUCC   124 Target Full Sequence	2.0	Sequence 1260 from Patent EP2074227	NA	coding protein	psRNATarget
LQ235573.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   |||=||*|||||||||||||| targets:104   CCUUGAACCAGACAACAUUCC   124 Target Full Sequence	2.0	Sequence 1568 from Patent EP2985353	NA	coding protein	psRNATarget
DQ245486.1	ncRNA:21   GGAGCU--CGGUCUGUUGUAAGG   1   ==||||--||||||||||||||| targets:427   UUUCGACAGCCAGACAACAUUCC   449 Target Full Sequence	2.5	Zea mays clone 16069 mRNA sequence	NA	coding protein	psRNATarget
LQ235071.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   =||||*|||||||=||||||| targets:71   UCUCGCGCCAGACGACAUUCC   91 Target Full Sequence	2.5	Sequence 1066 from Patent EP2985353	NA	coding protein	psRNATarget
HI402941.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   =||||*|||||||=||||||| targets:71   UCUCGCGCCAGACGACAUUCC   91 Target Full Sequence	2.5	Sequence 1066 from Patent EP2074227	NA	coding protein	psRNATarget
JB163701.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   =||||*|||||||=||||||| targets:71   UCUCGCGCCAGACGACAUUCC   91 Target Full Sequence	2.5	Sequence 1365 from Patent EP2559767	NA	coding protein	psRNATarget
JB163402.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   =||||*|||||||=||||||| targets:71   UCUCGCGCCAGACGACAUUCC   91 Target Full Sequence	2.5	Sequence 1066 from Patent EP2559767	NA	coding protein	psRNATarget
HI403240.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   =||||*|||||||=||||||| targets:71   UCUCGCGCCAGACGACAUUCC   91 Target Full Sequence	2.5	Sequence 1365 from Patent EP2074227	NA	coding protein	psRNATarget
LQ235370.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   =||||*|||||||=||||||| targets:71   UCUCGCGCCAGACGACAUUCC   91 Target Full Sequence	2.5	Sequence 1365 from Patent EP2985353	NA	coding protein	psRNATarget
LQ235261.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   =|||*|*|||||||||||||| targets:114   UCUCCAACCAGACAACAUUCC   134 Target Full Sequence	2.0	Sequence 1256 from Patent EP2985353	NA	coding protein	psRNATarget
HI403131.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   =|||*|*|||||||||||||| targets:114   UCUCCAACCAGACAACAUUCC   134 Target Full Sequence	2.0	Sequence 1256 from Patent EP2074227	NA	coding protein	psRNATarget
JB163898.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   =|||*|*|||||||||||||| targets:114   UCUCCAACCAGACAACAUUCC   134 Target Full Sequence	2.0	Sequence 1562 from Patent EP2559767	NA	coding protein	psRNATarget
LQ235567.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   =|||*|*|||||||||||||| targets:114   UCUCCAACCAGACAACAUUCC   134 Target Full Sequence	2.0	Sequence 1562 from Patent EP2985353	NA	coding protein	psRNATarget
HI403437.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   =|||*|*|||||||||||||| targets:114   UCUCCAACCAGACAACAUUCC   134 Target Full Sequence	2.0	Sequence 1562 from Patent EP2074227	NA	coding protein	psRNATarget
JB163592.1	ncRNA:21   GGAGCUCGGUCUGUUGUAAGG   1   =|||*|*|||||||||||||| targets:114   UCUCCAACCAGACAACAUUCC   134 Target Full Sequence	2.0	Sequence 1256 from Patent EP2559767	NA	coding protein	psRNATarget

Reference

1	PMID:14999285 "microRNA-mediated repression of rolled leaf1 specifies maize leaf polarity"; Juarez MT, Kui JS, Thomas J, Heller BA, Timmermans MC; Nature. 428:84-88(2004).
2	PMID:19936050 "A genome-wide characterization of microRNA genes in maize"; Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D; PLoS Genet. 5:e1000716(2009).