ncRNA ID | zma-miR169e |
Species | Zea mays |
Class | miRNA |
Genome position | chr4:47513568-47513695 [-] |
Reference genome | RefGen_v2 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 88 - UAGCCAAGGAGACUGCCUACG - 108 |
Stem-loop(if miRNA) |
GC          --A   A  C          -    -     -C A   AACACAAAGGUCCACAA   AAUAGGGGCC   CUC GG UAGCCAAGGA GACU GCCUA  G ACC                 U   ||||||||||   ||| || |||||||||| |||| |||||  | |||                 U   UUAUUCCCGG   GAG CU AUCGGUUCCU CUGA CGGAU  A GGA                 C --          ACG   A  -          A    A     AC -   AACAAAUGUUUCCUAGU |
Stem-loop sequence | GCAAUAGGGGCCACUCAGGCUAGCCAAGGAGACUGCCUACGAACCAACACAAAGGUCCACAAUUCUGAUCCUUUGUAAACAAAGGACAUAGGCAAGUCAUCCUUGGCUAUCAGAGGCAGGCCCUUAUU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
HI403434.1 |
|
2.0 | Sequence 1559 from Patent EP2074227 | NA | coding protein | psRNATarget | |||||||||
JB163895.1 |
|
2.0 | Sequence 1559 from Patent EP2559767 | NA | coding protein | psRNATarget | |||||||||
LQ235564.1 |
|
2.0 | Sequence 1559 from Patent EP2985353 | NA | coding protein | psRNATarget | |||||||||
EU968670.1 |
|
1.0 | Zea mays clone 323259 hypothetical protein mRNA, complete cds | NA | coding protein | psRNATarget | |||||||||
LQ242308.1 |
|
1.0 | Sequence 8303 from Patent EP2985353 | NA | coding protein | psRNATarget | |||||||||
HI410178.1 |
|
1.0 | Sequence 8303 from Patent EP2074227 | NA | coding protein | psRNATarget | |||||||||
JB170639.1 |
|
1.0 | Sequence 8303 from Patent EP2559767 | NA | coding protein | psRNATarget | |||||||||
BT061088.2 |
|
1.0 | Zea mays full-length cDNA clone ZM_BFb0099C08 mRNA, complete cds | NA | coding protein | psRNATarget |
1 | PMID:12101121
"MicroRNAs in plants"; Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP; Genes Dev. 16:1616-1626(2002). |
2 | PMID:12202040
"Prediction of plant microRNA targets"; Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP; Cell. 110:513-520(2002). |
3 | PMID:16040653
"Expression of Arabidopsis MIRNA genes"; Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC; Plant Physiol. 138:2145-2154(2005). |
4 | PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"; Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC; Genome Res. 16:1276-1288(2006). |
5 | PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"; Rajagopalan R, Vaucheret H, Trejo J, Bartel DP; Genes Dev. 20:3407-3425(2006). |
6 | PMID:19815687
"Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis"; Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW; J Exp Bot. 61:165-177(2010). |