ncRNA ID | zma-miR2275b-3p |
Species | Zea mays |
Class | miRNA |
Genome position | chr4:30201689-30201770 [+] |
Reference genome | RefGen_v2 |
Source | miRBase |
Length | 22 |
Mature sequence(if miRNA) | 51 - UUCAGUUUCCUCUAAUAUCUCA - 72 |
Stem-loop(if miRNA) |
    C   AG     -        C         --AU  U CCAU UGA  UGAGG AUUAGAGG AACUGAACC    CA C |||| |||  ||||| |||||||| |||||||||    || U GGUA GCU  ACUCU UAAUCUCC UUGACUUGG    GU A     A   CU     A        U         AAAC  U |
Stem-loop sequence | CCAUCUGAAGUGAGGAUUAGAGGCAACUGAACCAUCAUCUAUUGCAAAGGUUCAGUUUCCUCUAAUAUCUCAUCUCGAAUGG |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
EU966034.1 |
|
2.5 | Zea mays clone 291049 mRNA sequence | NA | coding protein | psRNATarget |
1 | PMID:19584097
"Clusters and superclusters of phased small RNAs in the developing inflorescence of rice"; Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH; Genome Res. 19:1429-1440(2009). |