ncRNA ID | zma-miR2275d-3p |
Species | Zea mays |
Class | miRNA |
Genome position | chr2:201408880-201408999 [+] |
Reference genome | RefGen_v2 |
Source | miRBase |
Length | 22 |
Mature sequence(if miRNA) | 93 - UUUGUUUUCCUCUAAUAUCUCA - 114 |
Stem-loop(if miRNA) |
GUCAGGCACUAAAA      -            A    UAAU    U    -GA  C    AUG               GUGAGA GUUGGAGGAAAG AAAC    CGGC AUCA   UU UGCA   G               |||||| |||||||||||| ||||    |||| ||||   || ||||   C               CACUCU UAAUCUCCUUUU UUUG    GCCG UAGU   AA ACGU   U ---------ACUUC      A            G    CCUU    U    ACA  U    AGU |
Stem-loop sequence | GUCAGGCACUAAAAGUGAGAGUUGGAGGAAAGAAAACUAAUCGGCUAUCAGAUUCUGCAAUGGCUUGAUGCAUAAACAUGAUUGCCGUUCCGUUUGUUUUCCUCUAAUAUCUCACCUUCA |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
EU950405.1 |
|
0.0 | Zea mays clone 490782 mRNA sequence | NA | coding protein | psRNATarget |
1 | PMID:19584097
"Clusters and superclusters of phased small RNAs in the developing inflorescence of rice"; Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH; Genome Res. 19:1429-1440(2009). |