Search result

BaseInfo

ncRNA ID	vvi-miR167c
Species	Vitis vinifera
Class	miRNA
Genome position	chrUn:7495686-7495776 [+]
Reference genome	Genoscope-20100122
Source	miRBase
Length	21
Mature sequence(if miRNA)	11 - UGAAGCUGCCAGCAUGAUCUC - 31
Stem-loop(if miRNA)	--  G      U   A       G        CAA   C   AUAC   CA UAGCAG UGA GCUGCCA CAUGAUCU   CUU CCU    A   || |||||| ||| ||||||| ||||||||   ||| |||   GU GUUGUC ACU CGAUGGU GUACUAGA   GAA GGA    A GG  A      C   C       -        CUA   A   ACUG
Stem-loop sequence	CAGUAGCAGUUGAAGCUGCCAGCAUGAUCUCAACUUCCCUAUACAAGUCAAGGAAAGAUCAGAUCAUGUGGUAGCCUCACCUGUUGAUGGG

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
KA173445.1	ncRNA:21   CUCUAGUACGACCGUCGAAGU   1   *|||||||||||||||||||| targets:618   UAGAUCAUGCUGGCAGCUUCA   638 Target Full Sequence	0.0	TSA: Vitis vinifera Locus_24147_Transcript_2/2_Confidence_1.000.Vivi mRNA sequence	NA	coding protein	psRNATarget
KA173444.1	ncRNA:21   CUCUAGUACGACCGUCGAAGU   1   *|||||||||||||||||||| targets:651   UAGAUCAUGCUGGCAGCUUCA   671 Target Full Sequence	0.0	TSA: Vitis vinifera Locus_24147_Transcript_1/2_Confidence_1.000.Vivi mRNA sequence	NA	coding protein	psRNATarget

Reference

1

PMID:17721507 "The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla"; Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro F, Anthouard V, Vico V, Del Fabbro C, Alaux M, Di Gaspero G, Dumas V, Felice N, Paillard S, Juman I, Moroldo M, Scalabrin S, Canaguier A, Le Clainche I, Malacrida G, Durand E, Pesole G, Laucou V, Chatelet P, Merdinoglu D, Delledonne M, Pezzotti M, Lecharny A, Scarpelli C, Artiguenave F, Pe ME, Valle G, Morgante M, Caboche M, Adam-Blondon AF, Weissenbach J, Quetier F, Wincker P; Nature. 449:463-467(2007).

2

PMID:19939267 "High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera"; Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS; BMC Genomics. 10:558(2009).