ncRNA ID | vvi-miR394c |
Species | Vitis vinifera |
Class | miRNA |
Genome position | chr18:3551260-3551361 [-] |
Reference genome | Genoscope-20100122 |
Source | miRBase |
Length | 22 |
Mature sequence(if miRNA) | 71 - UUGGCAUUCUGUCCACCUCCAU - 92 |
Stem-loop(if miRNA) |
--        U            U  A      UAUAUA   AUUCUUCUGAA   CAGAGCCA UUUGGCAUUCUG CC CCUCCA      CCA           U   |||||||| |||||||||||| || ||||||      |||   GUCUCGGU AAACCGUAGGAC GG GGAGGU      GCG           U AU        U            C  C      ----UU   AACACCCGCGG |
Stem-loop sequence | CAGAGCCAUUUUGGCAUUCUGUCCACCUCCAUAUAUACCAAUUCUUCUGAAUUGGCGCCCACAAGCGUUUGGAGGCGGCCAGGAUGCCAAAUUGGCUCUGUA |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_010657682.2 |
|
1.0 | PREDICTED: Vitis vinifera F-box only protein 6 (LOC100242085), mRNA | NA | coding protein | psRNATarget |
1 | PMID:17721507
"The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla"; Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro F, Anthouard V, Vico V, Del Fabbro C, Alaux M, Di Gaspero G, Dumas V, Felice N, Paillard S, Juman I, Moroldo M, Scalabrin S, Canaguier A, Le Clainche I, Malacrida G, Durand E, Pesole G, Laucou V, Chatelet P, Merdinoglu D, Delledonne M, Pezzotti M, Lecharny A, Scarpelli C, Artiguenave F, Pe ME, Valle G, Morgante M, Caboche M, Adam-Blondon AF, Weissenbach J, Quetier F, Wincker P; Nature. 449:463-467(2007). |
2 | PMID:19939267
"High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera"; Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS; BMC Genomics. 10:558(2009). |