Search result

BaseInfo

ncRNA ID vvi-miR171g
Species Vitis vinifera
Class miRNA
Genome position chr18:3255625-3255700 [+]
Reference genome Genoscope-20100122
Source miRBase
Length 21
Mature sequence(if miRNA) 46 - UUGAGCCGAACCAAUAUCACC - 66
Stem-loop(if miRNA) GCCA C   --UCC          -CA    U    GAC
    G CUC     AUGUUGGUUC   UCGG GGGG   A
    | |||     ||||||||||   |||| ||||
    C GAG     UAUAACCAAG   AGUU CCUC   C
UAAA C   CCCAC          CCG    -    AAC
Stem-loop sequence GCCAGCCUCUCCAUGUUGGUUCCAUCGGUGGGGGACACCAACUCCUUGAGCCGAACCAAUAUCACCCGAGCCAAAU

Targets Info

Target Acc Alignment Exception Target Description Target Gene Name Target Type Method
XM_002284390.4
ncRNA:21   CCACUAUAACCAAGCCGAGUU   1
  |||||||||||||||||||||
targets:499   GGUGAUAUUGGUUCGGCUCAA   519

0.0 PREDICTED: Vitis vinifera nodulation-signaling pathway 2 protein (LOC100250491), mRNA NA coding protein psRNATarget

Reference

1 PMID:17721507
"The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla";
Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro F, Anthouard V, Vico V, Del Fabbro C, Alaux M, Di Gaspero G, Dumas V, Felice N, Paillard S, Juman I, Moroldo M, Scalabrin S, Canaguier A, Le Clainche I, Malacrida G, Durand E, Pesole G, Laucou V, Chatelet P, Merdinoglu D, Delledonne M, Pezzotti M, Lecharny A, Scarpelli C, Artiguenave F, Pe ME, Valle G, Morgante M, Caboche M, Adam-Blondon AF, Weissenbach J, Quetier F, Wincker P;
Nature. 449:463-467(2007).
2 PMID:19939267
"High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera";
Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS;
BMC Genomics. 10:558(2009).