ncRNA ID | vvi-miR482 |
Species | Vitis vinifera |
Class | miRNA |
Genome position | chr17:5523024-5523140 [+] |
Reference genome | Genoscope-20100122 |
Source | miRBase |
Length | 22 |
Mature sequence(if miRNA) | 86 - UCUUUCCUACUCCUCCCAUUCC - 107 |
Stem-loop(if miRNA) |
--AAUGUU       U    -          C     CA    UU    ----      UUU         UGGGAAU GGAG AGUAGGAAAG UUAGC  UCUA  CCCU    UCAUGG   C         ||||||| |||| |||||||||| |||||  ||||  ||||    ||||||         AUCCUUA CCUC UCAUCCUUUC GAUCG  AGAU  GGGG    GGUACC   C CUUUUGUU       C    C          U     --    CU    GUUA      UCU |
Stem-loop sequence | AAUGUUUGGGAAUUGGAGAGUAGGAAAGCUUAGCCAUCUAUUCCCUUCAUGGUUUCCUCUCCAUGGAUUGGGGGUCUAGAGCUAGUCUUUCCUACUCCUCCCAUUCCUAUUGUUUUC |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
FQ393905.1 |
|
2.5 | Vitis vinifera clone SS0AFA23YJ09 | NA | coding protein | psRNATarget |
1 | PMID:17721507
"The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla"; Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro F, Anthouard V, Vico V, Del Fabbro C, Alaux M, Di Gaspero G, Dumas V, Felice N, Paillard S, Juman I, Moroldo M, Scalabrin S, Canaguier A, Le Clainche I, Malacrida G, Durand E, Pesole G, Laucou V, Chatelet P, Merdinoglu D, Delledonne M, Pezzotti M, Lecharny A, Scarpelli C, Artiguenave F, Pe ME, Valle G, Morgante M, Caboche M, Adam-Blondon AF, Weissenbach J, Quetier F, Wincker P; Nature. 449:463-467(2007). |
2 | PMID:19939267
"High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera"; Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS; BMC Genomics. 10:558(2009). |