Search result

BaseInfo

ncRNA ID vvi-miR479
Species Vitis vinifera
Class miRNA
Genome position chr16:21573759-21573852 [+]
Reference genome Genoscope-20100122
Source miRBase
Length 22
Mature sequence(if miRNA) 11 - UGUGGUAUUGGUUCGGCUCAUC - 32
Stem-loop(if miRNA) ---   G   U  U                  A    CUUUCAUUCAU
   GUA ACA GG GUGGUAUUGGUUCGGCUC UCUU           U
   ||| ||| || |||||||||||||||||| ||||
   CGU UGU UC CACUAUAACCAAGCCGAG AGAA           U
CUU   A   -  U                  C    ACUCGGCUACU
Stem-loop sequence GUAGACAUGGUGUGGUAUUGGUUCGGCUCAUCUUCUUUCAUUCAUUUUCAUCGGCUCAAAGACGAGCCGAACCAAUAUCACUCUUGUAUGCUUC

Reference

1 PMID:17721507
"The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla";
Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro F, Anthouard V, Vico V, Del Fabbro C, Alaux M, Di Gaspero G, Dumas V, Felice N, Paillard S, Juman I, Moroldo M, Scalabrin S, Canaguier A, Le Clainche I, Malacrida G, Durand E, Pesole G, Laucou V, Chatelet P, Merdinoglu D, Delledonne M, Pezzotti M, Lecharny A, Scarpelli C, Artiguenave F, Pe ME, Valle G, Morgante M, Caboche M, Adam-Blondon AF, Weissenbach J, Quetier F, Wincker P;
Nature. 449:463-467(2007).
2 PMID:19939267
"High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera";
Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS;
BMC Genomics. 10:558(2009).