ncRNA ID | vvi-miR479 |
Species | Vitis vinifera |
Class | miRNA |
Genome position | chr16:21573759-21573852 [+] |
Reference genome | Genoscope-20100122 |
Source | miRBase |
Length | 22 |
Mature sequence(if miRNA) | 11 - UGUGGUAUUGGUUCGGCUCAUC - 32 |
Stem-loop(if miRNA) |
---   G   U  U                  A    CUUUCAUUCAU    GUA ACA GG GUGGUAUUGGUUCGGCUC UCUU           U    ||| ||| || |||||||||||||||||| ||||    CGU UGU UC CACUAUAACCAAGCCGAG AGAA           U CUU   A   -  U                  C    ACUCGGCUACU |
Stem-loop sequence | GUAGACAUGGUGUGGUAUUGGUUCGGCUCAUCUUCUUUCAUUCAUUUUCAUCGGCUCAAAGACGAGCCGAACCAAUAUCACUCUUGUAUGCUUC |
1 | PMID:17721507
"The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla"; Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro F, Anthouard V, Vico V, Del Fabbro C, Alaux M, Di Gaspero G, Dumas V, Felice N, Paillard S, Juman I, Moroldo M, Scalabrin S, Canaguier A, Le Clainche I, Malacrida G, Durand E, Pesole G, Laucou V, Chatelet P, Merdinoglu D, Delledonne M, Pezzotti M, Lecharny A, Scarpelli C, Artiguenave F, Pe ME, Valle G, Morgante M, Caboche M, Adam-Blondon AF, Weissenbach J, Quetier F, Wincker P; Nature. 449:463-467(2007). |
2 | PMID:19939267
"High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera"; Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS; BMC Genomics. 10:558(2009). |