ncRNA ID | vvi-miR171a |
Species | Vitis vinifera |
Class | miRNA |
Genome position | chr14:25491201-25491299 [-] |
Reference genome | Genoscope-20100122 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 12 - UGAUUGAGCCGUGCCAAUAUC - 32 |
Stem-loop(if miRNA) |
UG   GGA             G            AACC    AU    A   GUG   AGCGUGAUGUUGG ACGGCUCAAUCA    AAAG  CUCA U   |||   ||||||||||||| ||||||||||||    ||||  |||| G   CAU   UUGUACUAUAACC UGCCGAGUUAGU    UUUC  GAGU G --   AAC             G            CUAA    CU    U |
Stem-loop sequence | UGGUGGGAAGCGUGAUGUUGGGACGGCUCAAUCAAACCAAAGAUCUCAAUGGUUGAGUCCUUUAAUCUGAUUGAGCCGUGCCAAUAUCAUGUUCAAUAC |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
FQ387249.1 |
|
1.5 | Vitis vinifera clone SS0AEB27YD06 | NA | coding protein | psRNATarget | |||||||||
FQ396308.1 |
|
1.5 | Vitis vinifera clone SS0AFA10YI14 | NA | coding protein | psRNATarget | |||||||||
XM_002268409.4 |
|
1.5 | PREDICTED: Vitis vinifera scarecrow-like protein 15 (LOC100251313), mRNA | NA | coding protein | psRNATarget | |||||||||
KA156503.1 |
|
1.5 | TSA: Vitis vinifera Locus_4453_Transcript_3/8_Confidence_0.250.Vivi mRNA sequence | NA | coding protein | psRNATarget | |||||||||
XM_010664124.2 |
|
1.5 | PREDICTED: Vitis vinifera scarecrow-like protein 22 (LOC100252271), transcript variant X2, mRNA | NA | coding protein | psRNATarget | |||||||||
XM_010663377.2 |
|
1.5 | PREDICTED: Vitis vinifera scarecrow-like protein 27 (LOC100267664), mRNA | NA | coding protein | psRNATarget | |||||||||
KA147554.1 |
|
1.5 | TSA: Vitis vinifera Locus_15685_Transcript_1/2_Confidence_0.600.Vivi mRNA sequence | NA | coding protein | psRNATarget | |||||||||
XM_010664120.2 |
|
1.5 | PREDICTED: Vitis vinifera scarecrow-like protein 22 (LOC100252271), transcript variant X1, mRNA | NA | coding protein | psRNATarget | |||||||||
JA894826.1 |
|
2.5 | Sequence 143 from Patent WO2011067745 | NA | coding protein | psRNATarget | |||||||||
KA139855.1 |
|
2.5 | TSA: Vitis vinifera Locus_55207_Transcript_1/1_Confidence_1.000.Vivi mRNA sequence | NA | coding protein | psRNATarget |
1 | PMID:17721507
"The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla"; Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro F, Anthouard V, Vico V, Del Fabbro C, Alaux M, Di Gaspero G, Dumas V, Felice N, Paillard S, Juman I, Moroldo M, Scalabrin S, Canaguier A, Le Clainche I, Malacrida G, Durand E, Pesole G, Laucou V, Chatelet P, Merdinoglu D, Delledonne M, Pezzotti M, Lecharny A, Scarpelli C, Artiguenave F, Pe ME, Valle G, Morgante M, Caboche M, Adam-Blondon AF, Weissenbach J, Quetier F, Wincker P; Nature. 449:463-467(2007). |
2 | PMID:19939267
"High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera"; Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS; BMC Genomics. 10:558(2009). |