ncRNA ID | vvi-miR394a |
Species | Vitis vinifera |
Class | miRNA |
Genome position | chr12:17122004-17122092 [-] |
Reference genome | Genoscope-20100122 |
Source | miRBase |
Length | 22 |
Mature sequence(if miRNA) | 58 - UUGGCAUUCUGUCCACCUCCAU - 79 |
Stem-loop(if miRNA) |
--                 U   U         UGCACAUCAUG   CAGAGCCAUUUUGGCAU CUG CCACCUCCA           G   ||||||||||||||||| ||| |||||||||           G   GUCUCGGUGAAACCGUA GAC GGUGGAGGU           U AU                 C   C         UUUCUUAUAUC |
Stem-loop sequence | CAGAGCCAUUUUGGCAUUCUGUCCACCUCCAUGCACAUCAUGGGUCUAUAUUCUUUUGGAGGUGGCCAGCAUGCCAAAGUGGCUCUGUA |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_010657682.2 |
|
1.0 | PREDICTED: Vitis vinifera F-box only protein 6 (LOC100242085), mRNA | NA | coding protein | psRNATarget |
1 | PMID:17721507
"The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla"; Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro F, Anthouard V, Vico V, Del Fabbro C, Alaux M, Di Gaspero G, Dumas V, Felice N, Paillard S, Juman I, Moroldo M, Scalabrin S, Canaguier A, Le Clainche I, Malacrida G, Durand E, Pesole G, Laucou V, Chatelet P, Merdinoglu D, Delledonne M, Pezzotti M, Lecharny A, Scarpelli C, Artiguenave F, Pe ME, Valle G, Morgante M, Caboche M, Adam-Blondon AF, Weissenbach J, Quetier F, Wincker P; Nature. 449:463-467(2007). |
2 | PMID:19939267
"High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera"; Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS; BMC Genomics. 10:558(2009). |