Search result

BaseInfo

ncRNA ID vvi-miR394a
Species Vitis vinifera
Class miRNA
Genome position chr12:17122004-17122092 [-]
Reference genome Genoscope-20100122
Source miRBase
Length 22
Mature sequence(if miRNA) 58 - UUGGCAUUCUGUCCACCUCCAU - 79
Stem-loop(if miRNA) --                 U   U         UGCACAUCAUG
  CAGAGCCAUUUUGGCAU CUG CCACCUCCA           G
  ||||||||||||||||| ||| |||||||||           G
  GUCUCGGUGAAACCGUA GAC GGUGGAGGU           U
AU                 C   C         UUUCUUAUAUC
Stem-loop sequence CAGAGCCAUUUUGGCAUUCUGUCCACCUCCAUGCACAUCAUGGGUCUAUAUUCUUUUGGAGGUGGCCAGCAUGCCAAAGUGGCUCUGUA

Targets Info

Target Acc Alignment Exception Target Description Target Gene Name Target Type Method
XM_010657682.2
ncRNA:22   UACCUCCACCUGUCUUACGGUU   1
  |*||||||*|||||||||||||
targets:1212   AAGGAGGUUGACAGAAUGCCAA   1233

1.0 PREDICTED: Vitis vinifera F-box only protein 6 (LOC100242085), mRNA NA coding protein psRNATarget

Reference

1 PMID:17721507
"The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla";
Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro F, Anthouard V, Vico V, Del Fabbro C, Alaux M, Di Gaspero G, Dumas V, Felice N, Paillard S, Juman I, Moroldo M, Scalabrin S, Canaguier A, Le Clainche I, Malacrida G, Durand E, Pesole G, Laucou V, Chatelet P, Merdinoglu D, Delledonne M, Pezzotti M, Lecharny A, Scarpelli C, Artiguenave F, Pe ME, Valle G, Morgante M, Caboche M, Adam-Blondon AF, Weissenbach J, Quetier F, Wincker P;
Nature. 449:463-467(2007).
2 PMID:19939267
"High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera";
Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS;
BMC Genomics. 10:558(2009).