ncRNA ID | vvi-miR169t |
Species | Vitis vinifera |
Class | miRNA |
Genome position | chr11:16399567-16399676 [+] |
Reference genome | Genoscope-20100122 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 11 - CGAGUCAAGGAUGACUUGCCG - 31 |
Stem-loop(if miRNA) |
--     G    C        GAU         -A       UU  G     A   G   AGGGU GAAU GAGUCAAG   GACUUGCCG  UAUAUAU  GC GAAGG CUU C   ||||| |||| ||||||||   |||||||||  |||||||  || ||||| |||   UCCCG UUUG CUCAGUUC   UUGAACGGC  AUGUGUA  CG UUUCC GGG A UC     G    A        -AG         CA       -U  A     -   U |
Stem-loop sequence | AGGGUGGAAUCGAGUCAAGGAUGACUUGCCGAUAUAUAUUUGCGGAAGGACUUGCAUGGGCCUUUAGCUAUGUGUAACCGGCAAGUUGACUUGACUCAGUUUGGCCCUCU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
KA148814.1 |
|
1.5 | TSA: Vitis vinifera Locus_94_Transcript_94/196_Confidence_1.000.Vivi mRNA sequence | NA | coding protein | psRNATarget |
1 | PMID:17721507
"The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla"; Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro F, Anthouard V, Vico V, Del Fabbro C, Alaux M, Di Gaspero G, Dumas V, Felice N, Paillard S, Juman I, Moroldo M, Scalabrin S, Canaguier A, Le Clainche I, Malacrida G, Durand E, Pesole G, Laucou V, Chatelet P, Merdinoglu D, Delledonne M, Pezzotti M, Lecharny A, Scarpelli C, Artiguenave F, Pe ME, Valle G, Morgante M, Caboche M, Adam-Blondon AF, Weissenbach J, Quetier F, Wincker P; Nature. 449:463-467(2007). |
2 | PMID:19939267
"High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera"; Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS; BMC Genomics. 10:558(2009). |