ncRNA ID | vvi-miR395j |
Species | Vitis vinifera |
Class | miRNA |
Genome position | chr1:6553026-6553111 [+] |
Reference genome | Genoscope-20100122 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 56 - CUGAAGUGUUUGGGGGAACUC - 76 |
Stem-loop(if miRNA) |
--GCCC  UA         UG C       C      -  UUC       CC  GAGUUCCCC  A CACUUCA UGGGGA UC   U       ||  |||||||||  | ||||||| |||||| ||   U       GG  CUCAAGGGG  U GUGAAGU AUCCUU AG   U UACUGU  UC         GU U       C      C  UAA |
Stem-loop sequence | GCCCCCUAGAGUUCCCCUGACCACUUCACUGGGGAUCUUCUUUAAUGACUUCCUACUGAAGUGUUUGGGGGAACUCCUGGUGUCAU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
KA152876.1 |
|
2.0 | TSA: Vitis vinifera Locus_15568_Transcript_1/3_Confidence_0.600.Vivi mRNA sequence | NA | coding protein | psRNATarget | |||||||||
XM_010665998.2 |
|
2.0 | PREDICTED: Vitis vinifera low affinity sulfate transporter 3 (LOC100252269), mRNA | NA | coding protein | psRNATarget | |||||||||
KA152875.1 |
|
2.0 | TSA: Vitis vinifera Locus_15568_Transcript_2/3_Confidence_0.600.Vivi mRNA sequence | NA | coding protein | psRNATarget | |||||||||
XM_010654522.2 |
|
2.0 | PREDICTED: Vitis vinifera low affinity sulfate transporter 3 (LOC100257574), mRNA | NA | coding protein | psRNATarget |
1 | PMID:17721507
"The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla"; Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro F, Anthouard V, Vico V, Del Fabbro C, Alaux M, Di Gaspero G, Dumas V, Felice N, Paillard S, Juman I, Moroldo M, Scalabrin S, Canaguier A, Le Clainche I, Malacrida G, Durand E, Pesole G, Laucou V, Chatelet P, Merdinoglu D, Delledonne M, Pezzotti M, Lecharny A, Scarpelli C, Artiguenave F, Pe ME, Valle G, Morgante M, Caboche M, Adam-Blondon AF, Weissenbach J, Quetier F, Wincker P; Nature. 449:463-467(2007). |
2 | PMID:19939267
"High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera"; Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS; BMC Genomics. 10:558(2009). |