ncRNA ID | vvi-miR395a |
Species | Vitis vinifera |
Class | miRNA |
Genome position | chr1:6527928-6528019 [+] |
Reference genome | Genoscope-20100122 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 62 - CUGAAGUGUUUGGGGGAACUC - 82 |
Stem-loop(if miRNA) |
--GUCC  UA         UG U       C       - UUCGCU       CC  GAGUUCCCU  A CACUUCA UAGGGAG C      A       ||  |||||||||  | ||||||| ||||||| |      G       GG  CUCAAGGGG  U GUGAAGU AUCCUUC G      U AGCCAU  UC         GU U       C       A UAAUUU |
Stem-loop sequence | GUCCCCUAGAGUUCCCUUGAUCACUUCACUAGGGAGCUUCGCUAGUUUUAAUGACUUCCUACUGAAGUGUUUGGGGGAACUCCUGGUACCGA |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
KA152876.1 |
|
2.0 | TSA: Vitis vinifera Locus_15568_Transcript_1/3_Confidence_0.600.Vivi mRNA sequence | NA | coding protein | psRNATarget | |||||||||
XM_010665998.2 |
|
2.0 | PREDICTED: Vitis vinifera low affinity sulfate transporter 3 (LOC100252269), mRNA | NA | coding protein | psRNATarget | |||||||||
KA152875.1 |
|
2.0 | TSA: Vitis vinifera Locus_15568_Transcript_2/3_Confidence_0.600.Vivi mRNA sequence | NA | coding protein | psRNATarget | |||||||||
XM_010654522.2 |
|
2.0 | PREDICTED: Vitis vinifera low affinity sulfate transporter 3 (LOC100257574), mRNA | NA | coding protein | psRNATarget |
1 | PMID:17721507
"The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla"; Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro F, Anthouard V, Vico V, Del Fabbro C, Alaux M, Di Gaspero G, Dumas V, Felice N, Paillard S, Juman I, Moroldo M, Scalabrin S, Canaguier A, Le Clainche I, Malacrida G, Durand E, Pesole G, Laucou V, Chatelet P, Merdinoglu D, Delledonne M, Pezzotti M, Lecharny A, Scarpelli C, Artiguenave F, Pe ME, Valle G, Morgante M, Caboche M, Adam-Blondon AF, Weissenbach J, Quetier F, Wincker P; Nature. 449:463-467(2007). |
2 | PMID:19939267
"High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera"; Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS; BMC Genomics. 10:558(2009). |