Search result

BaseInfo

ncRNA ID vvi-miR398a
Species Vitis vinifera
Class miRNA
Genome position chr1:731608-731710 [+]
Reference genome Genoscope-20100122
Source miRBase
Length 21
Mature sequence(if miRNA) 73 - UGUGUUCUCAGGUCACCCCUU - 93
Stem-loop(if miRNA) --ACA         A   GC            CG U           C  CAA
     CCCCAAGGG GUG  ACCUGAGAACAC  G UGUGUUGGCUG GC   G
     ||||||||| |||  ||||||||||||  | ||||||||||| ||
     GGGGUUUCC CAC  UGGACUCUUGUG  U ACGUAAUCGAU CG   C
ACCAC         C   --            UU U           -  UCU
Stem-loop sequence ACACCCCAAGGGAGUGGCACCUGAGAACACCGGUUGUGUUGGCUGCGCCAAGCUCUGCUAGCUAAUGCAUUUUGUGUUCUCAGGUCACCCCUUUGGGGCACCA

Reference

1 PMID:17721507
"The grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla";
Jaillon O, Aury JM, Noel B, Policriti A, Clepet C, Casagrande A, Choisne N, Aubourg S, Vitulo N, Jubin C, Vezzi A, Legeai F, Hugueney P, Dasilva C, Horner D, Mica E, Jublot D, Poulain J, Bruyere C, Billault A, Segurens B, Gouyvenoux M, Ugarte E, Cattonaro F, Anthouard V, Vico V, Del Fabbro C, Alaux M, Di Gaspero G, Dumas V, Felice N, Paillard S, Juman I, Moroldo M, Scalabrin S, Canaguier A, Le Clainche I, Malacrida G, Durand E, Pesole G, Laucou V, Chatelet P, Merdinoglu D, Delledonne M, Pezzotti M, Lecharny A, Scarpelli C, Artiguenave F, Pe ME, Valle G, Morgante M, Caboche M, Adam-Blondon AF, Weissenbach J, Quetier F, Wincker P;
Nature. 449:463-467(2007).
2 PMID:19939267
"High throughput approaches reveal splicing of primary microRNA transcripts and tissue specific expression of mature microRNAs in Vitis vinifera";
Mica E, Piccolo V, Delledonne M, Ferrarini A, Pezzotti M, Casati C, Del Fabbro C, Valle G, Policriti A, Morgante M, Pesole G, Pe ME, Horner DS;
BMC Genomics. 10:558(2009).