Search result

BaseInfo

ncRNA ID	rco-miR171c
Species	Ricinus communis
Class	miRNA
Genome position	30190:627331-627417 [-]
Reference genome	TIGR0.1
Source	miRBase
Length	21
Mature sequence(if miRNA)	6 - UGAUUGAGCCGUGCCAAUAUC - 26
Stem-loop(if miRNA)	--UCU                     A  CG   C       U      GAUGUUGGCAUGGUUCAAUCA AU  AAG ACUCAGC G      ||||||||||||||||||||| ||  ||| ||||||| C      CUAUAACCGUGCCGAGUUAGU UA  UUC UGAGUCG C UACCG                     C  AU   U       U
Stem-loop sequence	UCUGAUGUUGGCAUGGUUCAAUCAAAUCGAAGCACUCAGCUGCCUGCUGAGUUCUUUAAUCUGAUUGAGCCGUGCCAAUAUCGCCAU

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_002511615.2	ncRNA:21   CUAUAACCGUGCCGAGUUAGU   1   |||||||||=||||||||||| targets:1722   GAUAUUGGCGCGGCUCAAUCA   1742 Target Full Sequence	1.5	PREDICTED: Ricinus communis scarecrow-like protein 6 (LOC8265856), mRNA	scarecrow-like protein 6(LOC8265856)	coding protein	psRNATarget
XM_015725220.1	ncRNA:21   CUAUAACCGUGCCGAGUUAGU   1   |||||||||=||||||||||| targets:2152   GAUAUUGGCGCGGCUCAAUCA   2172 Target Full Sequence	1.5	PREDICTED: Ricinus communis scarecrow-like protein 27 (LOC8265567), mRNA	scarecrow-like protein 27(LOC8265567)	coding protein	psRNATarget

Reference

1	PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants"; Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M; Nucleic Acids Res. 38:981-995(2010).