ncRNA ID | rco-miR535 |
Species | Ricinus communis |
Class | miRNA |
Genome position | 30178:215567-215657 [-] |
Reference genome | TIGR0.1 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 66 - UGACAACGAGAGAGAGCACGC - 86 |
Stem-loop(if miRNA) |
--  UG          G  A         U  UA  CU      A   UU  UUGACAACGA AG GAGCACGCU GU  GC  UCAUGU A   ||  |||||||||| || ||||||||| ||  ||  |||||| G   GA  AACUGUUGCU UC CUCGUGCGA CA  CG  GGUACA G UA  GU          A  C         C  CA  UU      A |
Stem-loop sequence | UUUGUUGACAACGAGAGAGAGCACGCUUGUUAGCCUUCAUGUAAGGAACAUGGUUGCACACCAGCGUGCUCCCUAUCGUUGUCAAUGAGAU |
1 | PMID:19942686
"Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants"; Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M; Nucleic Acids Res. 38:981-995(2010). |