Search result

BaseInfo

ncRNA ID	rco-miR393
Species	Ricinus communis
Class	miRNA
Genome position	30147:26964-27071 [+]
Reference genome	TIGR0.1
Source	miRBase
Length	21
Mature sequence(if miRNA)	6 - UCCAAAGGGAUCGCAUUGAUC - 26
Stem-loop(if miRNA)	--AAAG    A            U         UC       ---ACCUAA    G       UUCC AAGGGAUCGCAU GAUCUAAUG  GUUGGGU         AUGA U       |||| |||||||||||| |||||||||  |||||||         |||| U       AAGG UUCCCUAGCGUA CUAGGUUAC  UAACCUA         UAUU A CCUCUG    A            -         -U       AUAUCUAAA    A
Stem-loop sequence	AAAGUUCCAAAGGGAUCGCAUUGAUCUAAUGUCGUUGGGUACCUAAAUGAGUUAAUUAUAAAUCUAUAAUCCAAUUCAUUGGAUCAUGCGAUCCCUUAGGAAGUCUCC

Targets Info

Target Acc	Alignment	Exception	Target Description	Target Gene Name	Target Type	Method
XM_002512820.2	ncRNA:21   CUAGUUACGCUAGGGAAACCU   1   *|*|||||||||||||||||| targets:2112   AAACAAUGCGAUCCCUUUGGA   2132 Target Full Sequence	1.0	PREDICTED: Ricinus communis protein AUXIN SIGNALING F-BOX 2 (LOC8285276), mRNA	protein AUXIN SIGNALING F-BOX 2(LOC8285276)	coding protein	psRNATarget

Reference

1	PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants"; Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M; Nucleic Acids Res. 38:981-995(2010).