ncRNA ID | rco-miR166a |
Species | Ricinus communis |
Class | miRNA |
Genome position | 30089:790389-790537 [-] |
Reference genome | TIGR0.1 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 6 - UCGGACCAGGCUUCAUUCCCC - 26 |
Stem-loop(if miRNA) |
--           UU         A   CCUA    ----U     UG    ---   UUCAUUCAAUAUACUGAAAA   UAAGGGGAAUG  GUCUGGUUC AGG    CCUA     UGAUC  UUUC   AGU                    A   |||||||||||  ||||||||| |||    ||||     |||||  ||||   |||                    U   AUUCCCCUUAC  CGGACCAGG UCC    GGAU     ACUAG  UUAG   GUG                    C UA           UU         C   UCUA    UCUUU     -U    CUG   UCCUAUCAAAGGGUAUAUGU |
Stem-loop sequence | UAAGGGGAAUGUUGUCUGGUUCAAGGCCUACCUAUUGAUCUGUUUCAGUUUCAUUCAAUAUACUGAAAAAUCUGUAUAUGGGAAACUAUCCUGUGGUCGAUUUGAUCAUUUCUUAGGAUCUCCUCGGACCAGGCUUCAUUCCCCUUAAU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_002515931.2 |
|
1.0 | PREDICTED: Ricinus communis homeobox-leucine zipper protein ATHB-15 (LOC8273792), mRNA | homeobox-leucine zipper protein ATHB-15(LOC8273792) | coding protein | psRNATarget | |||||||||
XM_015717688.1 |
|
2.0 | PREDICTED: Ricinus communis homeobox-leucine zipper protein ATHB-8 (LOC8275667), mRNA | homeobox-leucine zipper protein ATHB-8(LOC8275667) | coding protein | psRNATarget | |||||||||
XM_002529900.2 |
|
2.0 | PREDICTED: Ricinus communis homeobox-leucine zipper protein REVOLUTA (LOC8266275), mRNA | homeobox-leucine zipper protein REVOLUTA(LOC8266275) | coding protein | psRNATarget | |||||||||
XM_015721762.1 |
|
2.0 | PREDICTED: Ricinus communis homeobox-leucine zipper protein ATHB-14 (LOC8265527), mRNA | homeobox-leucine zipper protein ATHB-14(LOC8265527) | coding protein | psRNATarget | |||||||||
XM_015723880.1 |
|
2.5 | PREDICTED: Ricinus communis uncharacterized protein DDB_G0288629 (LOC8277364), mRNA | uncharacterized protein DDB_G0288629(LOC8277364) | coding protein | psRNATarget |
1 | PMID:19942686
"Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants"; Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M; Nucleic Acids Res. 38:981-995(2010). |