ncRNA ID | rco-miR164b |
Species | Ricinus communis |
Class | miRNA |
Genome position | 29986:260730-260833 [-] |
Reference genome | TIGR0.1 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 79 - UGGAGAAGCAGGGCACGUGCA - 99 |
Stem-loop(if miRNA) |
-  -  C        CA             --CCCCAACAC   -     UUC  CC UG UGGAGAAG  GGGCACGUGCAAA           UCC UUGGU   U  || || ||||||||  |||||||||||||           ||| |||||   U  GG AC ACCUCUUC  CUCGUGCACGUUU           AGG AACCG   G U  U  A        CC             UCUCAUAUCAA   U     UAA |
Stem-loop sequence | CCUGCUGGAGAAGCAGGGCACGUGCAAACCCCAACACUCCUUGGUUUCUUGAAUGCCAAUGGAAACUAUACUCUUUUGCACGUGCUCCCCUUCUCCAACAUGGU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_002514690.2 |
|
1.0 | PREDICTED: Ricinus communis NAC domain-containing protein 100 (LOC8263409), mRNA | NAC domain-containing protein 100(LOC8263409) | coding protein | psRNATarget | |||||||||
XM_015725842.1 |
|
2.5 | PREDICTED: Ricinus communis NAC domain-containing protein 21/22 (LOC8266284), transcript variant X2, mRNA | NAC domain-containing protein 21/22(LOC8266284) | coding protein | psRNATarget | |||||||||
XM_002529908.2 |
|
2.5 | PREDICTED: Ricinus communis NAC domain-containing protein 21/22 (LOC8266284), transcript variant X1, mRNA | NAC domain-containing protein 21/22(LOC8266284) | coding protein | psRNATarget |
1 | PMID:19942686
"Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants"; Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M; Nucleic Acids Res. 38:981-995(2010). |