ncRNA ID | rco-miR403b |
Species | Ricinus communis |
Class | miRNA |
Genome position | 29889:375406-375503 [-] |
Reference genome | TIGR0.1 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 6 - UUAGAUUCACGCACAAACUCG - 26 |
Stem-loop(if miRNA) |
--  U U                G   C    ---CA  --AA    GUUC   UC C AGUUUGUGCGUGAAUC AGC CCAU     UC    GGCC    A   || | |||||||||||||||| ||| ||||     ||    ||||    U   AG G UCAAACACGCACUUAG UUG GGUA     AG    CCGG    U CU  U C                A   U    ACCUA  CACC    AGUU |
Stem-loop sequence | UCUCUAGUUUGUGCGUGAAUCGAGCCCCAUCAUCAAGGCCGUUCAUUUUGAGGCCCCACGAAUCCAAUGGUGUUAGAUUCACGCACAAACUCGUGAUC |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_002528951.2 |
|
0.0 | PREDICTED: Ricinus communis protein argonaute 2 (LOC8277528), mRNA | protein argonaute 2(LOC8277528) | coding protein | psRNATarget | |||||||||
XM_002519199.2 |
|
2.5 | PREDICTED: Ricinus communis DNA replication complex GINS protein SLD5 (LOC8258835), mRNA | DNA replication complex GINS protein SLD5(LOC8258835) | coding protein | psRNATarget |
1 | PMID:19942686
"Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants"; Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M; Nucleic Acids Res. 38:981-995(2010). |