ncRNA ID | rco-miR166e |
Species | Ricinus communis |
Class | miRNA |
Genome position | 27964:24073-24203 [+] |
Reference genome | TIGR0.1 |
Source | miRBase |
Length | 21 |
Mature sequence(if miRNA) | 106 - UCGGACCAGGCUUCAUUCCCC - 126 |
Stem-loop(if miRNA) |
--  A        UU      CU   G   U  C  --U     --   UUCAAUUUU    AUAG    A   UG GGGGAAUG  GUCUGG  CGA GAC CU UU   UGAUC  CCU         CUCC    AUCC A   || ||||||||  ||||||  ||| ||| || ||   |||||  |||         ||||    |||| U   AC CCCCUUAC  CGGACC  GCU CUG GA AG   ACUAG  GGG         GAGG    UAGG A UA  C        UU      AG   G   U  C  UUU     AU   --------U    GUUA    C |
Stem-loop sequence | UGAGGGGAAUGUUGUCUGGCUCGAGGACUCUCUUUUGAUCCCUUUCAAUUUUCUCCAUAGAUCCAAUACGGAUAUUGGGAGUGGGUAGAUCAUUUGACAGUGUCGUCGGACCAGGCUUCAUUCCCCCCAAU |
Target Acc | Alignment | Exception | Target Description | Target Gene Name | Target Type | Method | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
XM_002515931.2 |
|
1.0 | PREDICTED: Ricinus communis homeobox-leucine zipper protein ATHB-15 (LOC8273792), mRNA | homeobox-leucine zipper protein ATHB-15(LOC8273792) | coding protein | psRNATarget | |||||||||
XM_015717688.1 |
|
2.0 | PREDICTED: Ricinus communis homeobox-leucine zipper protein ATHB-8 (LOC8275667), mRNA | homeobox-leucine zipper protein ATHB-8(LOC8275667) | coding protein | psRNATarget | |||||||||
XM_002529900.2 |
|
2.0 | PREDICTED: Ricinus communis homeobox-leucine zipper protein REVOLUTA (LOC8266275), mRNA | homeobox-leucine zipper protein REVOLUTA(LOC8266275) | coding protein | psRNATarget | |||||||||
XM_015721762.1 |
|
2.0 | PREDICTED: Ricinus communis homeobox-leucine zipper protein ATHB-14 (LOC8265527), mRNA | homeobox-leucine zipper protein ATHB-14(LOC8265527) | coding protein | psRNATarget | |||||||||
XM_015723880.1 |
|
2.5 | PREDICTED: Ricinus communis uncharacterized protein DDB_G0288629 (LOC8277364), mRNA | uncharacterized protein DDB_G0288629(LOC8277364) | coding protein | psRNATarget |
1 | PMID:19942686
"Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants"; Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M; Nucleic Acids Res. 38:981-995(2010). |